ID: 1136499742

View in Genome Browser
Species Human (GRCh38)
Location 16:30664411-30664433
Sequence GAGAACAAGGAGGGGTGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 649}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136499742_1136499768 25 Left 1136499742 16:30664411-30664433 CCCCACCACCCCTCCTTGTTCTC 0: 1
1: 0
2: 4
3: 60
4: 649
Right 1136499768 16:30664459-30664481 CCACCCCTGCTGCAGGTGCCAGG 0: 1
1: 0
2: 8
3: 60
4: 564
1136499742_1136499769 26 Left 1136499742 16:30664411-30664433 CCCCACCACCCCTCCTTGTTCTC 0: 1
1: 0
2: 4
3: 60
4: 649
Right 1136499769 16:30664460-30664482 CACCCCTGCTGCAGGTGCCAGGG 0: 1
1: 0
2: 4
3: 50
4: 398
1136499742_1136499762 18 Left 1136499742 16:30664411-30664433 CCCCACCACCCCTCCTTGTTCTC 0: 1
1: 0
2: 4
3: 60
4: 649
Right 1136499762 16:30664452-30664474 CCCACCCCCACCCCTGCTGCAGG 0: 1
1: 1
2: 36
3: 194
4: 1181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136499742 Original CRISPR GAGAACAAGGAGGGGTGGTG GGG (reversed) Exonic
900484551 1:2915247-2915269 GAGTCCAAGGAGGGGCAGTGGGG + Intergenic
900803256 1:4750804-4750826 GAGAAGAAGGAGGAGTGAGGTGG + Intronic
901018686 1:6245353-6245375 GAGGAGGAGCAGGGGTGGTGGGG - Exonic
901450060 1:9330638-9330660 GAGAAAAAGGAGGGGAGGAAAGG - Intronic
901918639 1:12519837-12519859 GAGCACAATGAGAGGAGGTGGGG + Intergenic
902395785 1:16131937-16131959 GAGTCCAGGGAGGGGTCGTGGGG - Intronic
902578891 1:17396041-17396063 GTGGACAAGCAGAGGTGGTGTGG + Intronic
902664792 1:17929960-17929982 GACACCCTGGAGGGGTGGTGTGG + Intergenic
902781727 1:18709278-18709300 GAGCACCAGGAGCGGTGCTGGGG - Intronic
903149736 1:21398304-21398326 GAGGCCGGGGAGGGGTGGTGGGG - Intergenic
903287318 1:22285313-22285335 CTGACCAAGGAGGGCTGGTGTGG - Intergenic
903358948 1:22765017-22765039 GAGGACAGGCAGGGGTGCTGAGG + Intronic
903515602 1:23908917-23908939 GAGAGACAGGTGGGGTGGTGGGG + Intronic
903677222 1:25072091-25072113 GAGAACAATGCAGGGTGATGTGG + Intergenic
904205682 1:28853644-28853666 GAGAGCAAGGATGGGTAGAGGGG + Intronic
904459696 1:30668926-30668948 GAGGACATGGAGGGCTGGGGAGG + Intergenic
904955882 1:34283502-34283524 GAAAATAAGGAAGGGTGGTTTGG - Intergenic
905353066 1:37360730-37360752 GAGAACAAGTGCTGGTGGTGTGG - Intergenic
905655296 1:39682816-39682838 GAGAACACTGGGGGTTGGTGAGG + Intronic
905774382 1:40659162-40659184 GAGACAAAGTAGGGGTGGGGAGG + Intronic
906245019 1:44267388-44267410 AAGAAGAAGGAGGGGAGGAGAGG - Intronic
906274832 1:44507877-44507899 GAGAAAAAGAAGGGGGAGTGTGG - Intronic
906288333 1:44602969-44602991 GAGGAGGAGGAGGGGTGGTGTGG - Intronic
906564339 1:46787562-46787584 CAGAAAAAGGTGGTGTGGTGGGG - Intronic
906852952 1:49271705-49271727 GAGAAGAAGGAGGGGTAGGGAGG - Intronic
907008641 1:50942080-50942102 GAGAACATGGAGGGGTAAAGAGG - Intronic
907073579 1:51559115-51559137 GGGACCAAGGAGGGATGGGGAGG + Intergenic
907276276 1:53318278-53318300 GAGAACAACGAGCGGTGTTCTGG - Intronic
907509059 1:54944976-54944998 ATGAACGAGGAGGGGTGGAGTGG + Intergenic
909165608 1:72220395-72220417 GAGGACAGGGAGGGGAGGGGAGG - Intronic
910491243 1:87774228-87774250 GAGAAGAAAGAGGTGTGGCGTGG + Intergenic
910595019 1:88971708-88971730 AAGTGCAAGGAAGGGTGGTGGGG - Intronic
912557440 1:110526361-110526383 GAAGACAAGGAGGGCTGGAGGGG + Intergenic
912582542 1:110733940-110733962 AAAAAAAAGGGGGGGTGGTGGGG - Intergenic
912860762 1:113211770-113211792 GAGGACAGGGAGGGGAGATGGGG + Intergenic
912933646 1:113984785-113984807 GAGAACAAGGAGGGGAGCTTAGG - Intergenic
913054069 1:115141309-115141331 GAGGCCAGGGAGGGGTGGTCTGG + Intergenic
914224297 1:145707594-145707616 GAGAACAAGGAGGGGAGAGGGGG + Intronic
915046702 1:153023402-153023424 GACAACCAGGAGGGGTGGGCAGG + Intergenic
915242292 1:154532174-154532196 GAGCCCATGGCGGGGTGGTGGGG + Intronic
915355940 1:155255223-155255245 GAGCCCAGGGAGGGGTGGGGAGG + Exonic
915513234 1:156398460-156398482 GAGAACAAGGCCGGGTGCTGTGG - Intergenic
916068325 1:161154265-161154287 GGGACTAAGGAGGGATGGTGGGG + Intronic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917285935 1:173421463-173421485 GACAACAAGGAGGGGCAGTATGG - Intergenic
917502705 1:175599822-175599844 GATAGCAAGGAGGGGTGATTCGG + Intronic
917643666 1:177008408-177008430 GAGAGGAAGGGGGGGTGGAGAGG + Intronic
917739368 1:177947706-177947728 GAGGAGAGGGAGGGGAGGTGAGG + Intronic
918282424 1:183020415-183020437 GAGAAAAAGGAGGGATGGAGGGG - Intergenic
918446518 1:184622582-184622604 GAGAACACAGAGTGGTGTTGTGG + Exonic
919117273 1:193296191-193296213 GAGAACAAAAAGGGGTTATGAGG - Intergenic
920017696 1:202927002-202927024 GAGACCAAGGATGGGGGGTAGGG + Intronic
920073463 1:203320315-203320337 GGGAGGATGGAGGGGTGGTGAGG - Intergenic
920127181 1:203702583-203702605 AAGAACAAAGAAGGGAGGTGGGG - Intronic
920236175 1:204507536-204507558 GAGAGAAAGGAAGGATGGTGAGG + Intergenic
920520783 1:206623962-206623984 GAGAACAGCATGGGGTGGTGGGG - Intergenic
920594108 1:207251230-207251252 GACAACAAGGAGGGTTGGGAGGG - Intergenic
920760975 1:208783446-208783468 GAAAACAAGGAGGCCGGGTGTGG - Intergenic
921749413 1:218775535-218775557 GGGAATGAGGAGGGGTGTTGTGG - Intergenic
922211892 1:223492559-223492581 GAGCAGAAGGAGGGGTTGTCAGG + Intergenic
922337901 1:224632604-224632626 GAGAGCGGGGTGGGGTGGTGAGG + Intronic
922462530 1:225824313-225824335 GGGAACAAGAAGGGGAGTTGGGG + Intronic
922661911 1:227437527-227437549 GAGAAAGAGGAGGGGAGGGGAGG + Intergenic
922721214 1:227901222-227901244 GGTAACCAGGAGGGCTGGTGGGG - Intergenic
923051639 1:230394572-230394594 GAGCACAAGGAGAGGAGGGGAGG - Intronic
923199073 1:231694343-231694365 GAGAGCCAGGAGGGGTTGGGGGG - Exonic
1062791849 10:311678-311700 GAGAAGAGGGAGGGGTGGGGAGG + Intronic
1063075379 10:2711331-2711353 TAGGTCAAGGAGGGGTGATGTGG - Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1065171785 10:23037231-23037253 GAGATCAACCAAGGGTGGTGCGG - Intronic
1065321004 10:24510128-24510150 AAGAACAACTTGGGGTGGTGGGG + Intronic
1066648578 10:37634941-37634963 CAGAAGAATGAGGGGTGGTGAGG + Intergenic
1067031452 10:42880627-42880649 CAGAAGAATGAGGGGTGGTGAGG + Intergenic
1067174807 10:43938093-43938115 GAGAAGGAGGAGGAGTGTTGAGG + Intergenic
1067249287 10:44573825-44573847 GGGAGCAAGAAGGGGAGGTGTGG - Intergenic
1067653369 10:48173346-48173368 AAGAACGAGGAGGGGAAGTGAGG - Intronic
1068318445 10:55378799-55378821 GAGAAAAAGGAGGGAGGGAGAGG - Intronic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1068940024 10:62671410-62671432 GACAGCAAGGAGGGGTGAGGAGG - Exonic
1069078305 10:64061921-64061943 GAAAACAAGGAAGGGTGATATGG + Intergenic
1069308753 10:67006381-67006403 GAGAAAGAGAAGGGGTGGAGGGG - Intronic
1069663871 10:70142320-70142342 GACAACAGGGAGGGGAGGGGAGG - Intronic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1070313698 10:75292161-75292183 GAGAACAAGGAGGGCTGTGATGG - Intergenic
1070450060 10:76549099-76549121 TAGAAGAAGAAGGGGAGGTGGGG - Intronic
1070451651 10:76564388-76564410 GAGAGCAGTGAGGGGTGGTGTGG - Intergenic
1070670338 10:78373210-78373232 GAGAAAATGGAGAGGGGGTGAGG - Intergenic
1070718929 10:78743218-78743240 GGGAACAAAGAGGGGTGCTGAGG - Intergenic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1070916521 10:80158560-80158582 GAGTAGAAAGAGGGGTTGTGAGG + Intronic
1071561148 10:86647759-86647781 GAGATCAGCGAGGGGTTGTGGGG + Intergenic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1072717712 10:97762671-97762693 GAGTAAAAGGAGGTGTGGGGAGG + Intergenic
1073063662 10:100746164-100746186 GAGAAAAGGGAGGGACGGTGGGG - Exonic
1073303612 10:102485959-102485981 GAGGACAAGGAGGGGAGTTGGGG - Intronic
1074464113 10:113666831-113666853 CAGAGCAATGTGGGGTGGTGTGG - Intergenic
1074706632 10:116138674-116138696 GAGACCATGGTGGGTTGGTGGGG - Intronic
1074757366 10:116634561-116634583 GGGAATAGGGTGGGGTGGTGAGG - Intronic
1075022049 10:118959320-118959342 GATGCCAAGGAGGGGTGGGGAGG - Intergenic
1075531403 10:123233192-123233214 GAGAGAAAGGAGGGGAGGGGAGG - Intergenic
1075724191 10:124603325-124603347 TGTAACAAGGAGGGGTGGGGAGG - Intronic
1076491479 10:130864547-130864569 GAGGACAAGGAGGCTTGGAGAGG - Intergenic
1077021998 11:421062-421084 GAGATCAGGGAGGGGTCCTGGGG + Intronic
1077184758 11:1231081-1231103 GAGAACTAGCAGGGATGGAGCGG - Intronic
1077210776 11:1370100-1370122 GAGGAGGAGGAGGGGCGGTGAGG + Intergenic
1077304735 11:1864031-1864053 GAGAACCAGGAGCGGGGGAGAGG + Intronic
1077435834 11:2538799-2538821 CAGAACAAGATGGGGTGGGGTGG + Intronic
1077452296 11:2655687-2655709 GAGAGCATGGAGGGGAGCTGGGG - Intronic
1077483312 11:2826665-2826687 GAGAACAGAGAGGGGTGCAGAGG + Intronic
1077529827 11:3089966-3089988 GAGACAAAGGAGGGGAGGGGAGG + Intronic
1077529861 11:3090102-3090124 GAGATGAGGGAGGGGTGCTGAGG + Intronic
1077647229 11:3936368-3936390 AAGCACTAGGAGGGGTGTTGGGG + Intronic
1077917071 11:6618341-6618363 GAGTACAGTGAGGGGTGGGGTGG + Intronic
1078406462 11:11074331-11074353 GAGAACCTGGAGGGCTGGGGTGG + Intergenic
1078659664 11:13277272-13277294 AAGAAGAAGGAGGAGGGGTGAGG + Intronic
1079792352 11:24754371-24754393 GAGAACAGTGAAGGGTAGTGAGG - Intronic
1080684631 11:34504853-34504875 GAGAAAGAGGAGGGAGGGTGGGG + Intronic
1081824831 11:46039071-46039093 GGGAAGAAGGATGGGTTGTGGGG + Intronic
1082217735 11:49595201-49595223 GAGAACAAGGAGGGTCTGTAGGG + Intergenic
1083362581 11:62121273-62121295 GAAAAAAAGGAGGGGGGCTGAGG - Intergenic
1083362595 11:62121368-62121390 GAAAAAAAGGAGGGGGGCTGAGG - Intergenic
1083719382 11:64596819-64596841 GAGAACCAGGAGGGGTGCCTTGG - Intronic
1084054609 11:66624490-66624512 GCGACCAAAGAAGGGTGGTGTGG - Exonic
1084513996 11:69625835-69625857 GAAAATCAGGAGGGGTGGGGTGG - Intergenic
1084769562 11:71334002-71334024 GAAAACAAGGATGGGGGGTTGGG + Intergenic
1085624569 11:78062105-78062127 GAGCACAGGGAGGGGACGTGGGG - Intronic
1085671057 11:78465055-78465077 GAGCCCACGGAGGGGTGGGGAGG + Intronic
1085793597 11:79517232-79517254 GAGACCAAGGGTGGGTAGTGAGG + Intergenic
1086366929 11:86116500-86116522 GAGAACAAGTAGGGGGGTTGTGG + Intergenic
1086916096 11:92531635-92531657 GAGAACAGGTAGCGATGGTGTGG + Intronic
1086922909 11:92607304-92607326 GAGACTAAGGAAGGGGGGTGGGG + Intronic
1087307069 11:96500588-96500610 GAGAAGGAGGAGGGGTGGGATGG - Intronic
1087443928 11:98222005-98222027 AAGAACAAGGAGGTGGGGTGCGG - Intergenic
1088116033 11:106315914-106315936 GAGAGGAAGGAGGGGAGTTGGGG - Intergenic
1088190158 11:107219735-107219757 GAGAACTTGAAGGGGTGATGGGG - Intergenic
1088720231 11:112585655-112585677 GAGGACAAGGCTGGGTGGGGTGG + Intergenic
1089007690 11:115106004-115106026 GGGAAAAAGGAGGGGATGTGTGG - Intergenic
1089317325 11:117600870-117600892 GAGGAGAAGGAGGGGTAGGGAGG + Intronic
1089769533 11:120793414-120793436 AAGAAGAAGGAGGCCTGGTGAGG + Intronic
1090165211 11:124539215-124539237 GGGTACATGGAGGTGTGGTGTGG + Intergenic
1090231023 11:125103748-125103770 GAAAACCAGGAGAGGTAGTGTGG - Intronic
1090383999 11:126345992-126346014 GGGAAGGAGGAGGGGTGATGGGG - Intergenic
1090470902 11:126980265-126980287 AAGAGCAAGGAGGGATGGAGAGG + Intronic
1090493128 11:127183456-127183478 GAGAAGGAGGAGAGGAGGTGAGG + Intergenic
1090838840 11:130472671-130472693 GAGGAGGAGGAGGGGTGGGGCGG - Intronic
1091219624 11:133922392-133922414 GGTAAGAAGCAGGGGTGGTGGGG - Intronic
1091678594 12:2510073-2510095 ATGAAAAATGAGGGGTGGTGTGG - Intronic
1092113709 12:5983116-5983138 GTGGATGAGGAGGGGTGGTGTGG - Intronic
1092985215 12:13838592-13838614 GATAAGATGGGGGGGTGGTGGGG - Intronic
1093134723 12:15437083-15437105 TACATCAAGGAAGGGTGGTGTGG - Intronic
1093499295 12:19793713-19793735 GTGAACAAGGAGAGGAGGTAGGG + Intergenic
1093910733 12:24743938-24743960 GAGAGAAAGAAGGGTTGGTGAGG + Intergenic
1095728221 12:45475076-45475098 GAGAGAAAGTAGGGGTGGAGTGG - Intergenic
1096380248 12:51150988-51151010 GAAAGCAAGGAGTGCTGGTGAGG + Intronic
1096429129 12:51528932-51528954 GAGAACCAGGAGAGGTTCTGAGG + Intergenic
1096553746 12:52390774-52390796 GGGAACAAGGAGGAGCTGTGTGG + Intergenic
1096559778 12:52427728-52427750 GAGAACACTGAGAGGTGGAGAGG + Intronic
1096615209 12:52828803-52828825 CAGAAGATGGAGGGGTGGGGAGG - Intronic
1096644705 12:53025443-53025465 GAGAACCCCGAGGGGTGTTGGGG + Intronic
1096667511 12:53176097-53176119 GAATACAAGAAGGGGGGGTGAGG + Intronic
1096718200 12:53503410-53503432 TAGAACAAGGAGGTATGTTGGGG - Intronic
1096778706 12:53979598-53979620 GAGAACAAGAGGGTGTGATGGGG - Intergenic
1096795982 12:54077813-54077835 GAGAAGGAGGGCGGGTGGTGAGG + Intergenic
1097097549 12:56561756-56561778 GAGGCCAAGGAGGGGGGGGGTGG - Intronic
1097181760 12:57175710-57175732 GACAACAGTGAGGTGTGGTGGGG + Intronic
1098198423 12:68027421-68027443 GAGAAAATTGAGGGGTGGTGGGG + Intergenic
1098462784 12:70751319-70751341 TAGAACAGGGGTGGGTGGTGGGG - Intronic
1098628579 12:72702045-72702067 GAGACAAAGGAATGGTGGTGTGG - Intergenic
1098721961 12:73911756-73911778 CAGAGCTAGGAGGGGTGGGGTGG - Intergenic
1098806902 12:75032278-75032300 TAGAAGAAAGAGGGCTGGTGGGG - Intergenic
1099354558 12:81617932-81617954 GAGAAGAAGTAGAGGTGGTGTGG + Intronic
1099653236 12:85456519-85456541 GAGCACAAGGTTGGGGGGTGGGG - Intergenic
1100439184 12:94600024-94600046 TAAAAAAAGGAGTGGTGGTGGGG + Intronic
1100460811 12:94797499-94797521 AAATACAAGGAGGGGAGGTGTGG - Intergenic
1101160058 12:101964320-101964342 GACAAGAAGGAGGGGTTCTGAGG + Intronic
1101183634 12:102249715-102249737 GAGAACAGGCAGGGAAGGTGAGG - Intergenic
1101293218 12:103393321-103393343 GAGAAAAAGTAGGGGTGGGGAGG + Intronic
1101730924 12:107426273-107426295 GCGGACAAGGAGGGGAGGGGTGG + Intronic
1101843228 12:108342362-108342384 GAGAAGAAGGAGTGGGGGAGAGG + Intergenic
1102273699 12:111562428-111562450 GAGAAAAAGAAGGCCTGGTGTGG + Intronic
1102617742 12:114169294-114169316 GAGAACAAGGAAGGATGGGGTGG - Intergenic
1103915097 12:124372127-124372149 GAGAAGAAGGAGGGCGGGAGCGG - Exonic
1104402421 12:128487240-128487262 TAGAACAAGGAGGATGGGTGAGG - Intronic
1104667104 12:130655446-130655468 AAGACCAAGGAGGGGTGGGCAGG + Intronic
1104707889 12:130961433-130961455 GAGAAAATGGAGGAGGGGTGGGG - Intronic
1104873137 12:132014914-132014936 GAGACCCAGGACGGGGGGTGGGG - Intronic
1104971759 12:132533980-132534002 GAGAACAGGGAGGGGTGCAGGGG + Intronic
1105414321 13:20195157-20195179 GAGGAGAAGGAGGAGAGGTGAGG + Intergenic
1105433698 13:20359753-20359775 CTGACCAAGGTGGGGTGGTGGGG - Intergenic
1105542046 13:21324339-21324361 GAGAGAAAAGAGGGGTGGTCTGG - Intergenic
1105774800 13:23647961-23647983 AAAAAAAAGGGGGGGTGGTGTGG - Intronic
1106020278 13:25907743-25907765 AAGAAAAAGCAGGGGTGGAGTGG - Intronic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1107004955 13:35599175-35599197 CAGAAGTGGGAGGGGTGGTGAGG - Intronic
1107873156 13:44765210-44765232 TAGAGGAAGGAGGGGTGGGGAGG - Intergenic
1109206856 13:59492349-59492371 AGGAACAAAGAGGGGTGGTAGGG - Intergenic
1110076462 13:71250555-71250577 GAGAAAAAGGGAGAGTGGTGGGG + Intergenic
1110169446 13:72483509-72483531 AGGAAGAGGGAGGGGTGGTGAGG - Intergenic
1110664187 13:78096567-78096589 GAGAACCAGGAAAGCTGGTGGGG - Intergenic
1112182727 13:97100909-97100931 GAGAAAAAGGAGGGGGATTGGGG - Intergenic
1112467764 13:99658630-99658652 AGGAACAAGGAGGTGGGGTGGGG + Intronic
1112691077 13:101894748-101894770 GAAAAAAAGGAGGGAAGGTGAGG + Intronic
1113246541 13:108402935-108402957 GACACCAAGAAGGGGAGGTGGGG - Intergenic
1113547448 13:111165065-111165087 GAGAACATGTAGGGGTTGAGTGG + Intronic
1113600262 13:111563412-111563434 GAGAAACAGGAGGGGAGGGGAGG - Intergenic
1114259335 14:21025734-21025756 GACAACAAGGCGGGGAGGTGGGG + Intronic
1114657728 14:24326051-24326073 GAGAACAAAGAGGGCTGGGGGGG - Intronic
1115651593 14:35405824-35405846 GAGAGCAAGGAGGGGCGGGCAGG - Intergenic
1117340041 14:54784725-54784747 GAGGACAAGGAGGGGTAGGCAGG + Intronic
1117824809 14:59690286-59690308 GAAAACAAAGAGCGGAGGTGGGG + Intronic
1118837405 14:69486579-69486601 CAGAAGAAAGATGGGTGGTGGGG - Intronic
1119505698 14:75171192-75171214 GAGAGGAAGAAGGGGTGGTGAGG + Intronic
1119669722 14:76509303-76509325 CAGTAAAAGGAGGGTTGGTGGGG - Intergenic
1120359847 14:83485431-83485453 GAGAACATGGCGGGGGGGGGGGG - Intergenic
1121206943 14:92177348-92177370 GGGAACAAGCAGGGCTGTTGTGG + Intergenic
1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG + Intronic
1121562007 14:94882823-94882845 GAGAGCAGGCAAGGGTGGTGGGG - Intergenic
1122127110 14:99585339-99585361 GAGAGCACAGAGAGGTGGTGTGG + Intronic
1122428257 14:101624010-101624032 GAGAACCAGGATGTGGGGTGAGG - Intergenic
1122579460 14:102762408-102762430 GAGAATAAGGGAGGATGGTGGGG + Intergenic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1123859198 15:24446274-24446296 GTGAACAAGGAGCTGTGTTGGGG - Intergenic
1124217146 15:27816871-27816893 GAGGGCAGTGAGGGGTGGTGGGG - Intronic
1124530299 15:30499812-30499834 AAAAGCAAAGAGGGGTGGTGGGG - Intergenic
1124768360 15:32507876-32507898 AAAAGCAAAGAGGGGTGGTGGGG + Intergenic
1124791267 15:32729594-32729616 AATAACAAGGAGGTGAGGTGAGG - Intronic
1124858941 15:33419000-33419022 GAGGACAAAGAGGTGTGGTATGG + Intronic
1125312299 15:38393226-38393248 GACAACAACAAGTGGTGGTGAGG + Intergenic
1125774478 15:42199198-42199220 GAAAACAAGGAAGGGCAGTGAGG + Intronic
1126348933 15:47724559-47724581 GTGGACAGTGAGGGGTGGTGGGG + Intronic
1127442704 15:59026905-59026927 GAGAGCAAGGGGGGGTGGTTTGG - Intronic
1128002030 15:64202214-64202236 TAGAAGAACAAGGGGTGGTGTGG + Intronic
1128240689 15:66099184-66099206 AAGAAAAAGGAGGGGTGGGAGGG - Intronic
1128454577 15:67825434-67825456 CAGTGCAAGGAGGGGTGGGGAGG - Intronic
1128665883 15:69538158-69538180 TAGAACAAGTAGGGGAGGGGAGG + Intergenic
1128684823 15:69675983-69676005 GATAACTAAGAGGGGTGGGGTGG - Intergenic
1128802304 15:70504617-70504639 GGGAACAAGACGGGGTGGAGAGG - Intergenic
1129108975 15:73326528-73326550 GAGAACAGGTAGGGGTAGGGAGG + Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129170880 15:73807185-73807207 GAGAAAAAGAAGAGGAGGTGAGG + Intergenic
1129198932 15:73987122-73987144 GAGAGCAATGAGCAGTGGTGGGG + Intronic
1129372807 15:75108775-75108797 TAGGACACGGAGGGGTGGGGTGG - Intronic
1129761379 15:78131102-78131124 GAGAAAAGGGAGGGGCGGCGGGG + Intronic
1129933456 15:79431176-79431198 GGGAAGGAGGTGGGGTGGTGGGG + Intergenic
1130453458 15:84080292-84080314 GAGAAGGAGCAGGGCTGGTGGGG + Intergenic
1130530939 15:84747968-84747990 GAAAGCAAGCAGGGGTGGCGTGG - Intergenic
1130646679 15:85734233-85734255 AAGAACAGGGAGTGATGGTGGGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131229244 15:90647683-90647705 GAGGAGAAGGAGGGGTGTGGAGG - Intergenic
1131442277 15:92467973-92467995 TAGAAAAAGGAGGGATTGTGGGG - Exonic
1131617213 15:94029037-94029059 GAGGGTAAGAAGGGGTGGTGGGG + Intergenic
1131780912 15:95857700-95857722 GAAAACTAGGAGGTGGGGTGAGG + Intergenic
1131787712 15:95931060-95931082 GAGAATAAGCAGGGGTGTGGGGG + Intergenic
1132226083 15:100142376-100142398 GAGTACCGGGAGGGATGGTGAGG + Intronic
1132541998 16:514536-514558 GAGAAGATGGAGGAGTGGAGAGG + Intronic
1132695656 16:1200666-1200688 GAGGAGGAGGAGGGGTCGTGCGG + Intronic
1133970995 16:10567913-10567935 GAGAAAACGGAGGGGTAGCGAGG + Intronic
1134624477 16:15714103-15714125 GAGAACTGTGAGGAGTGGTGTGG + Intronic
1134650482 16:15904611-15904633 GAGACCATGGAGGAGTGGAGTGG - Intergenic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1137341112 16:47606727-47606749 GAGAACATGCAGGGGAGGGGTGG - Intronic
1137683361 16:50369358-50369380 GAGGAGAAGGAAGGGTGATGAGG - Intergenic
1137701737 16:50502588-50502610 GGGAACCAGAAGGGGAGGTGGGG - Intergenic
1137756109 16:50903637-50903659 GAGAATAGGGAGGGATGGTTTGG + Intergenic
1138567645 16:57845291-57845313 GAGTCCAGGGAGGGATGGTGGGG - Intronic
1139818507 16:69698483-69698505 GATAACAGTGAGGGGGGGTGGGG + Intronic
1140597737 16:76436076-76436098 TAGAACAAACAGGGGTGTTGGGG + Intronic
1140724420 16:77799250-77799272 GAGAAGAAGGAGGGGAGGGGAGG - Intronic
1141433009 16:83980619-83980641 CAGAACAAGGGTGGGTGGTGTGG + Intronic
1141511460 16:84514690-84514712 GAGGCTAAGGAGGGGTCGTGGGG + Intronic
1141678525 16:85530466-85530488 GCCAGCAGGGAGGGGTGGTGGGG + Intergenic
1144645924 17:16973323-16973345 GAGGACATGGAGAGGTGGAGAGG + Intergenic
1144854027 17:18258347-18258369 GAGAACACGGACGCGGGGTGGGG + Intronic
1145770061 17:27486525-27486547 GAGAATAAGGATGGGAAGTGGGG + Intronic
1145906975 17:28521625-28521647 GACATCAAGAAGGGGTGGTGGGG + Intronic
1146700211 17:34951534-34951556 GAGCACAGGGAGAGGAGGTGAGG - Intronic
1146908638 17:36633653-36633675 GAGAAGGAGGAGGGGAGGAGAGG + Intergenic
1146912814 17:36659153-36659175 CAGAACAAGGCAGGGTGGAGGGG + Intergenic
1147159031 17:38560019-38560041 GAGAACAAGGATGGGGGAGGGGG + Intronic
1147326927 17:39674057-39674079 GAGGACAGGGAAGGGTGGTGAGG + Intronic
1147494699 17:40904701-40904723 GAGAAAAAGGAAGGGTGGGGAGG + Intergenic
1147909844 17:43848940-43848962 GGGAAGAGGGAGGGGTGGTGGGG + Intronic
1148661312 17:49335537-49335559 GAGAACATGGTGGGGTAGGGTGG - Intronic
1148812385 17:50301882-50301904 GAGGACAAGGCTGGGAGGTGAGG - Intergenic
1148852705 17:50562396-50562418 GAGAACAAGATGTGGTGGAGGGG + Intronic
1149287097 17:55176940-55176962 GAGAACTAAGTGGGGAGGTGGGG - Intergenic
1149489948 17:57077370-57077392 GAGAAATAGGAGGGGATGTGTGG + Intergenic
1150582253 17:66484983-66485005 GAGATAAAGGAGGAGTGGGGAGG + Intronic
1151331877 17:73414773-73414795 GAGAACGGGGTGGGGTGGAGGGG + Intronic
1151413656 17:73947619-73947641 GAGGACAGGGAGGAGTGGGGAGG + Intergenic
1151436789 17:74102645-74102667 GAAAACAAGCGGGGTTGGTGGGG - Intergenic
1151520967 17:74629304-74629326 GAGAAGAAGAAGTGGTGGGGAGG + Intergenic
1151572305 17:74932916-74932938 GAGCTCAAGGAGGGCTGGGGTGG + Intronic
1151733862 17:75926744-75926766 GAGATCAAGGTAGGGTGGAGTGG - Exonic
1152084281 17:78208079-78208101 GAGAAAGAGGCGGTGTGGTGGGG - Intergenic
1152966741 18:123112-123134 GAGAACCAGCAGTGGTAGTGTGG - Intergenic
1153012885 18:555806-555828 GAGAACAAGGAGTGTTGTTATGG - Intergenic
1154013212 18:10593082-10593104 GAGAACTATGGGGGGTGGGGAGG + Intergenic
1154149820 18:11897725-11897747 AAGGTCAAGGAGGGGTGGTGGGG - Intronic
1154160420 18:11977183-11977205 GAGGCCAAGGCGGGGTGGGGAGG + Intergenic
1154254155 18:12768204-12768226 TAGAACAAGGGGTGGTGGTCAGG - Intergenic
1154927246 18:20948944-20948966 GAGAACCAGCAGTGGTAGTGTGG + Exonic
1155878051 18:31111382-31111404 GACAAGAAGGAGGGGTAGAGTGG - Intergenic
1156373170 18:36489412-36489434 GAGAACCAGGATGGGTGCAGTGG + Intronic
1156700228 18:39816427-39816449 GAGAAAAAGGACGGGTGCAGTGG - Intergenic
1156993497 18:43438914-43438936 GGACACAAGGAGGGGTGTTGTGG + Intergenic
1157141934 18:45117479-45117501 TAGTACAAGGAGAGGTGATGAGG + Intergenic
1157304849 18:46509416-46509438 GAGAAAGGGGAGGGGTGGTGTGG - Intronic
1157393678 18:47324404-47324426 GAGAACAGTGAGGGCAGGTGAGG + Intergenic
1158070240 18:53462041-53462063 GTGAAGAGGGAGGGGAGGTGAGG + Intronic
1158140171 18:54247090-54247112 AAGAACAAAGATGGGGGGTGGGG - Intergenic
1159135633 18:64333869-64333891 GGAGACAAGAAGGGGTGGTGTGG - Intergenic
1159550835 18:69894503-69894525 GAGAGAAAGGAGGGGAGGGGAGG + Intronic
1160111355 18:76034673-76034695 GAAAACAAGGGGAGGGGGTGAGG - Intergenic
1160470627 18:79129499-79129521 GAGAAAAAGGAGGGGCAGGGGGG - Intronic
1160474375 18:79168939-79168961 GAGAACAATGGGGGCTGGAGAGG - Intronic
1161195439 19:2983758-2983780 GAGAAGAAGGAGGAGGGATGAGG + Intronic
1161556033 19:4943246-4943268 AAAAAAAAGGGGGGGTGGTGAGG + Intronic
1161735758 19:5991285-5991307 GTCAGCAAGGAGGGGTGGGGAGG - Intergenic
1162131067 19:8526566-8526588 GTGAAGAAGGAGGGCTGGGGCGG - Exonic
1162142927 19:8595637-8595659 GAGAACCGGGAAGGGGGGTGAGG - Intronic
1162301858 19:9849065-9849087 GGGAGCCAGGAGGGGCGGTGGGG - Intronic
1162343785 19:10108028-10108050 GAGTACCAGGAGGGGTGGGTGGG - Exonic
1162658476 19:12150827-12150849 GACAACAAGGAGTGGTCATGAGG - Intronic
1162671287 19:12259933-12259955 GAGGACAGGGAGGGAAGGTGGGG - Intronic
1162882098 19:13667365-13667387 GAGAAAAGGGAGGGTTGGTTTGG - Intergenic
1163013572 19:14440417-14440439 GGGAACAAGGAGAGGAGATGGGG + Intronic
1163263313 19:16204208-16204230 TGGACCACGGAGGGGTGGTGGGG + Intronic
1163685143 19:18708341-18708363 GAGAACAGGGAAGGGAGTTGTGG + Intronic
1163689108 19:18729101-18729123 GAAAACAAGGCGGGCAGGTGCGG - Intronic
1163739213 19:19000321-19000343 GAGAATAAGGTGGGGTCGAGGGG - Intronic
1163811061 19:19431930-19431952 GAGCAAAGGCAGGGGTGGTGGGG + Intronic
1164623592 19:29712507-29712529 GTGAAAAAGGTTGGGTGGTGGGG - Intronic
1164740904 19:30575038-30575060 GACAACAAGGAGTGGAGGTAAGG - Intronic
1165435553 19:35792911-35792933 GAGAATAAGGAGGGTTACTGGGG + Intergenic
1165889663 19:39103386-39103408 GAGAATAAGGAGGGGATGAGTGG - Intronic
1166387659 19:42391153-42391175 GAGAAAAAGGCCGGGTGGAGTGG + Intergenic
1166666329 19:44682631-44682653 GGGAGCTGGGAGGGGTGGTGGGG + Intronic
1167389261 19:49183051-49183073 CAGCAAAAGGAGGGGTGGTGAGG - Intronic
1168289016 19:55347944-55347966 GAGACCCACGGGGGGTGGTGAGG - Exonic
926073634 2:9922557-9922579 GAGAATAATGAGGGGTGTTGGGG - Intronic
926147583 2:10406057-10406079 GACAGCAAGGAGGGGTGAAGGGG - Intronic
926215175 2:10901843-10901865 GAGGAGAAGGAGCGGGGGTGGGG + Intergenic
926234231 2:11027409-11027431 GTGAAGAAGGAGGGGAGGTTCGG - Intergenic
926332349 2:11835990-11836012 GAGAATCAGGAGGGGTGTGGGGG - Intergenic
926755133 2:16228248-16228270 GAGAACAACATGGGGTGGGGTGG - Intergenic
927099800 2:19779388-19779410 GAAGACAAGTAGGGTTGGTGTGG + Intergenic
927168700 2:20350732-20350754 GAGAAGGAGGAGGTGGGGTGGGG - Intronic
927347537 2:22063711-22063733 GAGAGAAAGGAGGGGAGGGGAGG - Intergenic
927387939 2:22557945-22557967 CAGGGCAAGGAGGGGTAGTGAGG + Intergenic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927700473 2:25265170-25265192 TAGAGCAGGGAGGGGTGGTCGGG + Intronic
927797345 2:26061752-26061774 AAAAACAAGGGGGGGTGGGGTGG - Intronic
929263050 2:39887754-39887776 GAGAAAACGGAGGCGTGGAGAGG + Intergenic
929302086 2:40316662-40316684 GAGAAAAAGCAGGAGTGATGAGG - Intronic
929453946 2:42053563-42053585 GCGCACAAGGAGGGGTGAGGAGG - Intronic
929461133 2:42102638-42102660 GAGAATGAGGCGGGGTGGGGTGG - Intergenic
929782936 2:44969343-44969365 GGGGACCAGGAGGGGTGGGGTGG + Intergenic
929943465 2:46352679-46352701 GAGAACAAGCAGGTGCTGTGAGG + Intronic
930099969 2:47595972-47595994 GAGAACAGGGAGGTGATGTGAGG - Intergenic
931234933 2:60405406-60405428 GGGGACAAGGAGGGGAGTTGAGG - Intergenic
931752339 2:65341037-65341059 GAGAAAGGGGCGGGGTGGTGGGG + Intronic
932153515 2:69394341-69394363 AAGAACAAGGAGGAAAGGTGTGG - Intergenic
932376253 2:71238605-71238627 GAGAACAAGGAGTGGCAGAGGGG + Intergenic
932485494 2:72081973-72081995 GAGACCAAGGAGGGGTGTGGGGG - Intergenic
932559005 2:72850968-72850990 GAGAACGTGGAGGTGCGGTGAGG + Intergenic
932923833 2:75947160-75947182 GAGAACCAGGAAAGGTAGTGGGG + Intergenic
933217649 2:79648730-79648752 GAACAAAAGGAGTGGTGGTGGGG - Intronic
936807108 2:116348082-116348104 GAGAGCATGGAGGTGTGGGGTGG + Intergenic
937277200 2:120692668-120692690 GAGAAGAAGGAGGGGTGAGGGGG - Intergenic
937630889 2:124099783-124099805 GAGAACAAGGCGGGGGGCAGGGG + Intronic
938166391 2:129030883-129030905 GAAAATAAGGAGTGTTGGTGAGG + Intergenic
938518202 2:132037947-132037969 GAGAAGAAGGAGGGCGGGGGCGG - Intergenic
940524781 2:154799464-154799486 AGGAAGGAGGAGGGGTGGTGGGG + Intronic
942247781 2:174023741-174023763 CAGGAGAAGGAGGGGTGGGGAGG + Intergenic
942394885 2:175536649-175536671 GAGAACCAGGAGAGCTGATGGGG - Intergenic
942431608 2:175917478-175917500 AAGAACAAGCTGGGGTGGGGAGG + Intergenic
942623650 2:177875844-177875866 GAGAACAGGTAGGGCTTGTGGGG - Exonic
942927103 2:181447095-181447117 AAGAACAGGGTGGGGTGGAGGGG - Intergenic
944093634 2:195942340-195942362 GAGAAGAAGGAAGGGTGGGGAGG + Intronic
945873157 2:215249186-215249208 GAAAACAATGCGGTGTGGTGTGG + Intergenic
945984537 2:216342927-216342949 GAGAGCAAGGTGGGGCTGTGGGG + Intronic
946109600 2:217403022-217403044 AAGAAAAAGGAGGGGTGGAAGGG - Intronic
946194266 2:218023784-218023806 CAAAACAAGGAGGGCTGGTGGGG - Intergenic
946601533 2:221365219-221365241 GGAAAGAAGGAAGGGTGGTGTGG + Intergenic
947295658 2:228627750-228627772 AAGAAGAAGGAGGGGAGGAGGGG - Intergenic
947581344 2:231321055-231321077 GAGAACACTGAGGCTTGGTGAGG - Intronic
947826023 2:233106598-233106620 GAGGAGGAGGAGGGGTGCTGTGG - Intronic
947894585 2:233657453-233657475 GAGAAAAAGGAGGGGTTGCCAGG + Intronic
947988764 2:234470682-234470704 GAGAACAAGGCCGGGTGTGGTGG - Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948340695 2:237248952-237248974 AGGAGCAAAGAGGGGTGGTGGGG + Intergenic
1168830187 20:841463-841485 GAGAGCCAGGAGGGGCGGCGAGG + Intronic
1168865734 20:1084899-1084921 GAAAATGAGGAGGTGTGGTGTGG - Intergenic
1168866342 20:1090112-1090134 GAGAAGAAGGAGGAAAGGTGAGG + Intergenic
1169019271 20:2316972-2316994 GAGGACAAGGTGGGGAGATGAGG - Intronic
1169423697 20:5479998-5480020 GAGAAGAACGAGTGTTGGTGAGG + Intergenic
1169634453 20:7672728-7672750 GAGCAAAAGGAGGGGAGATGTGG - Intergenic
1169730035 20:8776876-8776898 GAGAATAAGGAGGGGCGGTTTGG + Intronic
1169737659 20:8854454-8854476 GAGAAAAAGGAGAGGTGTTGGGG - Intronic
1169948515 20:11015398-11015420 AAGAATAAAGAGGTGTGGTGCGG - Intergenic
1171457225 20:25278911-25278933 GAGAACAGGGAGGGGTTCTGTGG - Intronic
1171982428 20:31637628-31637650 AACAGCAAGGAGGGGAGGTGTGG + Intergenic
1172227035 20:33311953-33311975 GAGAAGAAGGAGGTGGTGTGGGG - Intergenic
1172780258 20:37432619-37432641 GGGAACAAGGAAGGGGAGTGGGG - Intergenic
1173132785 20:40410268-40410290 AAGAGCAAGGAGGGGTGTTGTGG + Intergenic
1173465349 20:43276503-43276525 GAGAATAAGGTGAGGTGCTGGGG - Intergenic
1173562266 20:44014548-44014570 GGTAACAAGGAGGGGAGCTGGGG - Intronic
1173997939 20:47353791-47353813 GAGAAAAAGAAGGGGGGTTGGGG + Intronic
1174459722 20:50673727-50673749 GAGAGCATGGAGGCGTGGTGAGG - Intronic
1174611609 20:51802100-51802122 GTGCAAAAGGCGGGGTGGTGGGG + Intronic
1174812611 20:53660076-53660098 AAGAACAAGGGGGGGTGGGGAGG + Intergenic
1174825351 20:53763519-53763541 GAGAATAACTAGGGGTGGAGAGG - Intergenic
1175640903 20:60629388-60629410 GATAGCAAGGGGAGGTGGTGAGG + Intergenic
1176249486 20:64113511-64113533 GAGATCCAGAAAGGGTGGTGGGG - Intergenic
1176551273 21:8223474-8223496 GACGACAAGGGGGGGTGGGGGGG - Intergenic
1176570182 21:8406473-8406495 GACGACAAGGGGGGGTGGGGGGG - Intergenic
1176578091 21:8450660-8450682 GACGACAAGGGGGGGTGGGGGGG - Intergenic
1176842883 21:13854821-13854843 GGAAACAGCGAGGGGTGGTGCGG - Intergenic
1177781854 21:25630389-25630411 GAAAATAAGGTGGGGTGGGGAGG + Intergenic
1178486062 21:33020777-33020799 GGGCTCAAGGAGGGGTGGAGGGG + Intergenic
1179287865 21:39993607-39993629 GAGGACAAAGAGGAGTGGTTAGG + Intergenic
1179985478 21:44918498-44918520 GTGAAACAGGAGGGGTGGTCTGG - Intronic
1180122363 21:45762336-45762358 GAGAGCAAGGAGGGGTCACGGGG + Intronic
1180156722 21:45981725-45981747 GAGGGCAAGGAGGGGAGGGGCGG - Exonic
1180207222 21:46268511-46268533 GAGAGCAGGGAGCGCTGGTGGGG + Intronic
1180611715 22:17102537-17102559 GAGAACAAGGGGGCGTGTGGGGG - Intronic
1181474730 22:23161192-23161214 GAGAACAGGGAGGGCTAGGGAGG - Intronic
1181714754 22:24716587-24716609 GAGTACAAGCTGGAGTGGTGGGG - Intergenic
1181825477 22:25511991-25512013 AAGAACAATGTGAGGTGGTGTGG - Intergenic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1182326367 22:29516322-29516344 GAGAAGAAAGTGGGGTAGTGAGG + Intronic
1182350855 22:29698651-29698673 AAGAACACGGCTGGGTGGTGGGG + Intergenic
1182563480 22:31180099-31180121 CAGAACATGGCGGGGGGGTGGGG + Intronic
1182574914 22:31266529-31266551 GAGAACTGGGAGGGGGGGTCAGG + Intronic
1183244020 22:36679718-36679740 GAGAACAGGGAGAGCTGGAGTGG - Intronic
1183313544 22:37124754-37124776 GAGAAAAAGGAGGAGAGGTGGGG - Intergenic
1183485554 22:38086091-38086113 CAGTGCAGGGAGGGGTGGTGTGG - Intronic
1183633169 22:39045667-39045689 GAGCACAAGGAGTGTGGGTGAGG - Intronic
1183651096 22:39153466-39153488 GCGAAAAAGGAAGGGGGGTGGGG - Intergenic
1183656159 22:39185899-39185921 GAGACCAGGAAGGGGTGGTGGGG - Intergenic
1183780944 22:39998499-39998521 GAGAACATGAATGGGGGGTGAGG + Intronic
1183993463 22:41614870-41614892 GAAAACAAGGTGGGGTGAGGTGG - Intronic
1184032775 22:41904733-41904755 GTGAGCAAGGCAGGGTGGTGTGG + Intronic
1184723801 22:46331536-46331558 GAGAGCAGGGAGGGGTAGGGTGG + Intronic
1185100294 22:48836704-48836726 GAGTGAAAGGAGGGGTGATGGGG + Intronic
1185116853 22:48942755-48942777 GAGGACCAGGAGGGATGGAGGGG - Intergenic
1185148832 22:49153012-49153034 GAGCACAAGGCGGGGTCCTGGGG - Intergenic
1203256300 22_KI270733v1_random:140433-140455 GACGACAAGGGGGGGTGGGGGGG - Intergenic
949350572 3:3121465-3121487 GGGAAAAAGGAGTGGTGGGGAGG - Intronic
949493319 3:4609654-4609676 GAGAACATGGAGGGATGGAATGG + Intronic
949965658 3:9353927-9353949 GAGTACAAGGAAGGGAGGAGAGG + Intronic
950709419 3:14804151-14804173 GTGAACTCGGAGGGGTGGAGAGG - Intergenic
952989447 3:38818909-38818931 AAGAATAAGGAGGGGAGTTGTGG - Intergenic
953115717 3:39990269-39990291 GAGAAGAAGGAAGAGTAGTGTGG - Intronic
953176416 3:40557405-40557427 GAGAAAAAGGAATGTTGGTGGGG - Intronic
953365407 3:42340426-42340448 GAGAAGGAGGAGGGGGGGAGGGG + Intergenic
953443582 3:42941863-42941885 AAGAACAAGCAAGGGAGGTGAGG - Intronic
953545245 3:43859670-43859692 GAGGGCATGGAGGGCTGGTGTGG - Intergenic
954426681 3:50447113-50447135 AAGAAGAAGGAAGGCTGGTGAGG + Intronic
954661870 3:52230701-52230723 GGGATCAGGGAGGGGTGGGGTGG + Intronic
954705780 3:52479854-52479876 GAGAAGAAGGTGGGTTTGTGTGG + Exonic
954706385 3:52482949-52482971 GAGAACAGGGTAGGATGGTGTGG + Intronic
954900376 3:54014232-54014254 GAAATTAAGGAGGGGTGATGTGG + Intergenic
955211032 3:56941093-56941115 GAGAACTGGGAGAGGAGGTGGGG + Intronic
955371246 3:58354046-58354068 GTGAACCCAGAGGGGTGGTGTGG + Intronic
956760648 3:72440726-72440748 GAGAAAAAGCATGGGTGATGAGG + Intronic
956770857 3:72524887-72524909 GAGACCGAGGTTGGGTGGTGGGG - Intergenic
957240466 3:77654736-77654758 GAGAGCATTGAGGGTTGGTGTGG + Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958868099 3:99524964-99524986 GAGAAAAAGGGAGGGTGGAGAGG + Intergenic
959405958 3:105962027-105962049 GACAACTAGAAGCGGTGGTGGGG - Intergenic
961039661 3:123668742-123668764 GAGAAGGATGAGGGGTGCTGGGG - Intronic
961065023 3:123867871-123867893 GATAAGAAGGAGTGGTGTTGGGG - Intronic
961980645 3:131074341-131074363 GAAAACAAGGAGGGAAGGAGAGG + Intronic
962448249 3:135488239-135488261 GAGGGCAAGGAGGGGAGGTGGGG + Intergenic
962958332 3:140286785-140286807 TAGAAGAAGGAGGAGTAGTGGGG + Intronic
963138405 3:141928621-141928643 GAGAACAGCTGGGGGTGGTGTGG + Intergenic
963258936 3:143175100-143175122 GAGAACGAGCAGGGTTGCTGAGG + Intergenic
964509584 3:157436543-157436565 GGGATGAAGGAGGGGTGGTAGGG - Intronic
964828019 3:160850965-160850987 GAAAACAGGGAGGTGGGGTGGGG - Intronic
965730194 3:171763443-171763465 GAGAAAGAGGAGGGGAGGGGAGG + Intronic
965777810 3:172251366-172251388 TAGAAGAAGGAGGGCTGTTGAGG - Exonic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966974810 3:185074336-185074358 GAGATGAGGCAGGGGTGGTGTGG - Intergenic
967316143 3:188153844-188153866 GAGACCAAGGGGAGGGGGTGGGG + Intronic
967712372 3:192723957-192723979 GAGAGGAAGGAGGGGAGGGGAGG + Intronic
968440604 4:622071-622093 GAGGACAAGGAAGGGTGAGGAGG - Intergenic
968479995 4:829024-829046 GAGAAGGAGGAGGTGGGGTGTGG + Intergenic
968570968 4:1340517-1340539 GAGAACAGGGGTGGGCGGTGGGG - Intergenic
968684148 4:1945215-1945237 GGGAACAAGACGGGGTGGGGTGG + Intronic
968809879 4:2795017-2795039 GAGAAAACGGAGGGGTGGCAGGG - Intronic
969058666 4:4417957-4417979 CAGCACAGGGAGGGGTGGGGGGG - Exonic
969074796 4:4569409-4569431 GAGAACAAAAAGGGATGCTGGGG - Intergenic
969189333 4:5504421-5504443 GGGAACATGGTGTGGTGGTGGGG - Intergenic
969443877 4:7233241-7233263 GAGAACTAGGAAGGGTGGTGTGG + Intronic
969498447 4:7539556-7539578 GAAAACAAGGAGGGAGGGAGAGG - Intronic
969619947 4:8273875-8273897 GAGAGGAATGAGGGGTGGAGAGG - Intronic
969727186 4:8927297-8927319 GAGAAACAGGAGGGGTGCGGTGG - Intergenic
969976747 4:11110687-11110709 GAGAACAAGAATGGGTGGAAGGG - Intergenic
970536733 4:17037682-17037704 GAGATGAAGGAGGAGAGGTGGGG + Intergenic
971168605 4:24210100-24210122 TAGGACAAGGAGGGGAGGAGAGG - Intergenic
971177101 4:24292533-24292555 GAGGACAGGAAGGGGTGGGGTGG - Intergenic
971177405 4:24293378-24293400 AAGCACAGGAAGGGGTGGTGAGG - Intergenic
971289842 4:25327465-25327487 GAAAGGAAGGAAGGGTGGTGGGG - Intronic
971495838 4:27264296-27264318 GAGATGAAGGAAGTGTGGTGGGG + Intergenic
971759592 4:30748236-30748258 GAGGCCGAGAAGGGGTGGTGAGG + Intronic
973645668 4:52949086-52949108 GAGAACATGGAGCACTGGTGAGG - Intronic
973760130 4:54108126-54108148 GAGAACAAAGGGTGGGGGTGGGG - Intronic
974435828 4:61856489-61856511 GGAAAGAAGGAGGGGAGGTGAGG - Intronic
975653128 4:76614374-76614396 GAACACAATGAGGAGTGGTGAGG + Intronic
976112380 4:81689772-81689794 GAGAAATAAGAGGGGAGGTGGGG - Intronic
976421406 4:84848706-84848728 GAGAACAATGGGGGATGGAGAGG + Intronic
976537498 4:86235371-86235393 GAGGACAAAGAGGGCTTGTGGGG + Intronic
976946864 4:90781032-90781054 AAGAACAAGGAAGGGTGGCTGGG + Intronic
977305383 4:95317832-95317854 GAGACCGAGTAGGAGTGGTGGGG - Intronic
978147079 4:105388054-105388076 GAGAACAGGGGGCGGGGGTGGGG + Intronic
979439997 4:120740440-120740462 GAGAGGAAGGAGGGGAGGAGCGG - Intronic
979888939 4:126065342-126065364 GCTACCAAGGAGGGGAGGTGGGG + Intergenic
981091919 4:140741046-140741068 TAGAGCAGGGTGGGGTGGTGAGG + Intronic
982994230 4:162320264-162320286 CACAACAATGTGGGGTGGTGGGG - Intergenic
983722105 4:170868366-170868388 CAGAACAAGGAGGGGCCGTTGGG - Intergenic
984703609 4:182833513-182833535 GAGGAGAAGGAGGGGAGGGGAGG - Intergenic
984703681 4:182833712-182833734 GAGGAGAAGGAGGGGAGGGGAGG - Intergenic
984703897 4:182834320-182834342 GAGGAGAAGGAGGGGAGGGGAGG - Intergenic
985923911 5:3000794-3000816 GAGAAGGAGTAGGGGTGATGGGG + Intergenic
986279878 5:6314323-6314345 GAGAGCCAGGATGGGGGGTGCGG + Intergenic
987065843 5:14288798-14288820 GAAAACAAGAAGGGCTGGTCCGG - Intronic
987142241 5:14958241-14958263 TAGAATAAGGAGGGGAGGGGAGG - Intergenic
987203231 5:15598764-15598786 GAAGACAAGGAGGGGGAGTGAGG - Intronic
988623202 5:32844544-32844566 TAGAATGAGGAGGGGTGGTCAGG + Intergenic
988673756 5:33409905-33409927 GAAAAAAAGGAGGGGTGTTGGGG + Intergenic
988789450 5:34593916-34593938 GAGAACCAGGAAAGTTGGTGGGG + Intergenic
988982352 5:36584274-36584296 GTCAAGAAAGAGGGGTGGTGGGG + Intergenic
989353401 5:40514613-40514635 GGGCACAATGAGGGGTGGTGGGG - Intergenic
990181410 5:53164638-53164660 CAGTACCAGGAGGGGTGGTCAGG + Intergenic
990805762 5:59659786-59659808 GAGCTCAAGGATGTGTGGTGTGG - Intronic
992383920 5:76265721-76265743 GAGTGCAAGGAGCGGTGGAGGGG - Intronic
994284541 5:97948948-97948970 GAGAACGGGGAGGGGAGGGGAGG - Intergenic
994313261 5:98301734-98301756 GAGAAGAAAGTGGGGGGGTGGGG + Intergenic
994988544 5:106968777-106968799 GAAGACAATGAGGGGTGGTGGGG + Intergenic
995349887 5:111163077-111163099 GATAAAAAGGAGCTGTGGTGTGG + Intergenic
996256950 5:121415969-121415991 GTGGACAAGGAGGGGAGGTAAGG - Intergenic
996533331 5:124549406-124549428 GACAACATGGAGGGGTGCTCAGG + Intergenic
996559334 5:124811720-124811742 GAAAGCAATGAGGGGTGGGGTGG + Intergenic
997569363 5:134914268-134914290 GAGAGCAAGTAGGGGTGGAAGGG + Intronic
998849074 5:146337541-146337563 CTGAACGAGGTGGGGTGGTGTGG - Intronic
999261496 5:150241466-150241488 GAGAAGAAGGAGGAGAGGGGAGG - Intronic
999674201 5:153982682-153982704 GAGAATAAGGCCTGGTGGTGAGG - Intergenic
1000229538 5:159302304-159302326 GAGAACAAGTCGGAGTGGCGGGG + Intergenic
1001332587 5:170772712-170772734 GTGGGGAAGGAGGGGTGGTGGGG + Intronic
1001740366 5:174048067-174048089 GAGAACGTGCAGGGGTGGGGTGG + Intronic
1002111930 5:176921742-176921764 GAGACTAAGCAGGGGTGGAGGGG - Intronic
1002318305 5:178359909-178359931 GAGAACGAGGAGGGCTGCAGAGG + Intronic
1002434513 5:179222448-179222470 GAGAACCAGGAGGGGAGGGAGGG + Intronic
1002461334 5:179375446-179375468 AAGCACAAGGAGGGGGAGTGTGG - Intergenic
1003106544 6:3220979-3221001 GAGAAACACGAGGGGTGGGGAGG + Intergenic
1003137676 6:3445810-3445832 TACAACAAGGAGGGGTGGCAGGG + Intronic
1003410089 6:5854452-5854474 GAGAGCAAAGAGGGGTGGTCTGG + Intergenic
1003745027 6:8991142-8991164 GGGGCTAAGGAGGGGTGGTGGGG + Intergenic
1004015726 6:11730195-11730217 GACAACAAGGATGTGTTGTGTGG + Intronic
1004342049 6:14816591-14816613 GAGAGCACAGAGGTGTGGTGAGG - Intergenic
1005136129 6:22570709-22570731 GGGAAGCAGGAGGGGTGGAGAGG - Exonic
1006313185 6:33275886-33275908 GAGGACAAGGAAGGGGGCTGGGG + Intronic
1006316965 6:33297149-33297171 GAGGGCAATGGGGGGTGGTGTGG - Intronic
1006943109 6:37765898-37765920 GAGAAGAGGAAGGGGTGGTAGGG + Intergenic
1007671243 6:43555933-43555955 CACAACAAGGAGAGGTGATGAGG - Exonic
1008088384 6:47268036-47268058 GAGAAGGAGGAGTGGAGGTGTGG - Intronic
1009435434 6:63612919-63612941 GAGAAAAAGGTGGGATGGTAAGG - Intergenic
1010155154 6:72784055-72784077 TAGAGCCAGGAGAGGTGGTGTGG - Intronic
1010286658 6:74085510-74085532 GAGAAAAAGGAAGGGGGGTAAGG - Intergenic
1010563914 6:77384964-77384986 GAGACCAAGGCGGGGGGGCGGGG + Intergenic
1011255230 6:85413928-85413950 GAGAAAAAGGAGGGGTGGGGGGG + Intergenic
1012316510 6:97787509-97787531 AAGAACAAGAAGCGGGGGTGGGG + Intergenic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1012515052 6:100049616-100049638 GAGAAAAATGAGGCATGGTGAGG - Intergenic
1013835694 6:114332779-114332801 GAAAACAAAGAGAGGTAGTGTGG + Intronic
1015150040 6:130026935-130026957 GAGAAAATGGAGGGGTGGTGTGG + Intronic
1017106944 6:150896807-150896829 GAGACCAAGAAGGGGCTGTGTGG + Intronic
1017544459 6:155436106-155436128 GAGCACAAAGAAGGGTGGTGAGG + Intronic
1018134212 6:160763847-160763869 GAGAATAACAAGTGGTGGTGAGG + Intergenic
1018330949 6:162727371-162727393 GCGAACGAGGAGCGGGGGTGCGG + Intronic
1018429710 6:163713440-163713462 GAGAAGAGGGTGGGGTGGGGAGG - Intergenic
1018631583 6:165826815-165826837 GAGAGCCAGGAGGGGTGCTGGGG + Intronic
1018825426 6:167405040-167405062 GTGAACAAGGAGGGGACGGGAGG - Intergenic
1022587965 7:31633873-31633895 GAGAAAAAGCAGAGGTGATGGGG - Intronic
1022612763 7:31893791-31893813 GTGAACAATGAGGGGTTGTTTGG - Intronic
1022735433 7:33071338-33071360 GAGAAGGAGCAGGGGTGGTGTGG - Intergenic
1023845126 7:44116184-44116206 GGGAACATGCAGGGGTGGAGGGG + Exonic
1024173618 7:46815280-46815302 GAGAACACTGAGGGGAGGTTGGG - Intergenic
1024235604 7:47395152-47395174 GAGAACAGGGAGGCGAGTTGTGG - Intronic
1024777923 7:52809715-52809737 AAAAACAGGGAGGAGTGGTGGGG + Intergenic
1026106765 7:67427283-67427305 GAAAATAAGGAAGGGTGCTGTGG - Intergenic
1026844491 7:73690439-73690461 GGGAACAAGGAGGGGTGTGTGGG + Intronic
1026944004 7:74305026-74305048 AAGAGCAGGGAGGGGTGGTTTGG - Intronic
1026976050 7:74499122-74499144 GTGAATGAGTAGGGGTGGTGAGG + Intronic
1028581359 7:92412921-92412943 AAGAGGAAGGAGGGGTGCTGTGG - Intergenic
1028984249 7:96997437-96997459 GCAAAGAAGGAGGGGTGGAGCGG + Intergenic
1029112858 7:98222527-98222549 GATAGCAAGGAGGGGCGCTGAGG + Intronic
1029149825 7:98471982-98472004 GAGAACAAGGCCAGGTGCTGTGG + Intergenic
1030497141 7:110314440-110314462 GTGAACAAGGAGGGGAAGGGAGG - Intergenic
1030613067 7:111709674-111709696 GATATCAAGGATGGGTGATGAGG + Intergenic
1030623260 7:111815645-111815667 GAGAAAAAGGAGGGGAGGGGAGG - Intronic
1030650457 7:112111200-112111222 GACACCCAGGAGGGGTTGTGAGG + Intronic
1030887860 7:114961079-114961101 CAGAGCAGGCAGGGGTGGTGCGG - Intronic
1031633641 7:124075170-124075192 GAAAACAAGAAGGGGTGGAAGGG - Intergenic
1032446790 7:131991066-131991088 AGGACCAGGGAGGGGTGGTGGGG + Intergenic
1032462985 7:132125712-132125734 GAGGACCAGGAGGGATGGCGGGG + Exonic
1032466412 7:132148426-132148448 GGGAACATGGAGTGCTGGTGAGG + Intronic
1032534562 7:132651662-132651684 GAGAATAACAAGTGGTGGTGAGG + Intronic
1034375758 7:150642526-150642548 GAGGACAAGGAAGTCTGGTGTGG - Intergenic
1034406148 7:150903598-150903620 GAAAGCCAGGAGGGGTGATGTGG - Intergenic
1034422234 7:150996056-150996078 GAGAAGGAGGAGGGGTGCAGAGG - Intronic
1034422260 7:150996122-150996144 GAGAAGGAGGAGGGGTGCAGGGG - Intronic
1035383703 7:158456673-158456695 GAAAACAGGGAGGGGTGGCAGGG - Intronic
1035732185 8:1860871-1860893 CAGAGGATGGAGGGGTGGTGGGG + Intronic
1037124810 8:15335136-15335158 GAGAAAGATGATGGGTGGTGAGG - Intergenic
1037151917 8:15647029-15647051 GAGAAGAAGAAGAGGTGATGGGG - Intronic
1037300282 8:17444126-17444148 GAGGAGAAGGAGGAGTGGAGGGG - Intergenic
1037460200 8:19101216-19101238 GTGAATAAAGAGGAGTGGTGGGG + Intergenic
1037718108 8:21416971-21416993 TAGAACACCCAGGGGTGGTGAGG + Intergenic
1037734400 8:21555117-21555139 GAGGAGAAGGAGGGATGGGGAGG + Intergenic
1037765667 8:21770839-21770861 GAGGACCTGGAAGGGTGGTGTGG - Intronic
1037829381 8:22178935-22178957 GAGACCAAGGAAGGGTGGTGAGG + Intronic
1038943943 8:32336351-32336373 GAGAACAACCAGGTGTGGTCAGG + Intronic
1039583840 8:38688746-38688768 GAGAACAAAGGGGTGGGGTGGGG - Intergenic
1040399065 8:47029953-47029975 GAGAGAAAGGAGAGGTGGGGTGG + Intergenic
1041023079 8:53657777-53657799 CAGAGCAAGGATGGGGGGTGGGG - Intergenic
1041083359 8:54234361-54234383 GAGAACAAGCAGAGGTTTTGAGG + Intergenic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1041467499 8:58171719-58171741 TAGGACAAGGCGGGGTGGGGGGG - Intronic
1041901901 8:62991985-62992007 GAGAAGAAAGTGGGGTGGCGAGG - Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044794698 8:95885115-95885137 GACACAAAGGAGGGGTGGGGTGG - Intergenic
1045899513 8:107260540-107260562 GAGAATAAGTAGTAGTGGTGGGG + Intronic
1046104025 8:109645197-109645219 GAGGCCAAGGAGGGGTGGCCAGG - Exonic
1046312906 8:112462765-112462787 GAGGGGAAGGAGGAGTGGTGGGG - Intronic
1047312854 8:123706941-123706963 GAGAAGTAGGAGTGGAGGTGAGG - Intronic
1047749728 8:127871189-127871211 GAGCACCAGGAGGGGCTGTGTGG + Intergenic
1048447468 8:134502664-134502686 GAGAAGAAGGTGGGGTGATTTGG + Intronic
1048821841 8:138387443-138387465 GAGAGGAAGGTGGGGTGGAGAGG - Intronic
1049568974 8:143359594-143359616 GAGAACAAGGGGGCCTGGAGGGG + Intronic
1049614241 8:143569239-143569261 GAGAAACAGGAGGGGCGGGGCGG + Intronic
1049653935 8:143789565-143789587 TGGAACAAGGAGGGGTGTTGAGG - Intergenic
1049693317 8:143972218-143972240 GAGCACCCGGAGGGGTGCTGGGG - Intronic
1049732391 8:144185494-144185516 GAGGACAGCGAGGGGTGGCGCGG + Intronic
1050609110 9:7332891-7332913 AAGGACAAGGAGGGGAGGAGAGG - Intergenic
1051101955 9:13531994-13532016 AAGAGAAAGGAGGGGTGGAGAGG + Intergenic
1051105344 9:13572948-13572970 GAAAGCATGGGGGGGTGGTGAGG - Intergenic
1051237534 9:15017562-15017584 GAGAGGAGGGAGGTGTGGTGGGG - Intergenic
1052218675 9:25995611-25995633 GGGAAGAAGGAGGGATGGGGGGG - Intergenic
1052594986 9:30545697-30545719 GAAAAAAAGGAGGTGGGGTGGGG - Intergenic
1052712074 9:32069429-32069451 GATTTAAAGGAGGGGTGGTGAGG - Intergenic
1052779686 9:32768260-32768282 GGGAACAAGGAGGGTTTCTGTGG - Intergenic
1053785595 9:41650489-41650511 GAGAAGGAGGGCGGGTGGTGAGG + Intergenic
1054174314 9:61864455-61864477 GAGAAGGAGGGCGGGTGGTGAGG + Intergenic
1054449172 9:65393500-65393522 GAGAAGGAGGGCGGGTGGTGAGG + Intergenic
1054663224 9:67716336-67716358 GAGAAGGAGGGCGGGTGGTGAGG - Intergenic
1054795890 9:69301456-69301478 GATAATAAGGAGGCCTGGTGAGG + Intergenic
1054850649 9:69843455-69843477 GAGAAGTAGGAGGGGAGGGGAGG - Intronic
1055632483 9:78237864-78237886 GAGGCCAAGGCGGGGGGGTGTGG + Intronic
1055928302 9:81533063-81533085 GAGGGAAAGGAGGGGTGGTAGGG + Intergenic
1055958697 9:81798912-81798934 GAGAACAAGGAAGGGTGAGGAGG - Intergenic
1056079238 9:83073369-83073391 GGGTAGAAGGTGGGGTGGTGGGG - Intergenic
1056270821 9:84946571-84946593 GACAGCAATGAGGGGTGGTCAGG + Intronic
1057834355 9:98432300-98432322 GAGAAAAAGGGGTGGTGGTTGGG + Intronic
1058345339 9:103954391-103954413 GAGAAGGAGGAGGGTTGGTATGG + Intergenic
1059960809 9:119562695-119562717 GGGAACAAAGGGGAGTGGTGGGG + Intergenic
1060091374 9:120746621-120746643 GAGCCCACGGAGGGGTGGGGAGG - Intergenic
1060228151 9:121808730-121808752 GAGGACATGGAGGGGTGGGCTGG - Intergenic
1060976624 9:127768768-127768790 GAGGACAGGGAGGGGTGGGCTGG - Intronic
1061264114 9:129495912-129495934 GAGAACAGGGAAGGGTAGTGTGG - Intergenic
1061311486 9:129766100-129766122 GAGACCCAGGAGAGCTGGTGGGG + Intergenic
1061405670 9:130391901-130391923 TAGAAAAAAGAGGGGTAGTGCGG - Intronic
1061634871 9:131901119-131901141 GAGAAGAAGGAAGGGTGGAAAGG + Intronic
1061702477 9:132426474-132426496 GGAAACAGGGAGGGGGGGTGGGG - Intronic
1061714262 9:132509190-132509212 GAGAAAAGGGAGGCATGGTGAGG + Intronic
1061915638 9:133751811-133751833 GAGGACAAGGAAGAGTGGGGAGG - Intergenic
1061995615 9:134181320-134181342 GAGAGCAGGGAGAGGGGGTGAGG + Intergenic
1062017922 9:134301041-134301063 GAGAACAGGGATGGGAGGGGAGG + Intergenic
1062146352 9:134991932-134991954 CAGGAAAAGAAGGGGTGGTGGGG - Intergenic
1203472452 Un_GL000220v1:122118-122140 GACGACAAGGGGGGGTGGGGGGG - Intergenic
1185609021 X:1383316-1383338 AAAAACAAACAGGGGTGGTGGGG - Intergenic
1186108220 X:6227951-6227973 AAGAATAAGGGGGGGGGGTGGGG + Intronic
1187189971 X:17025088-17025110 GGGAAGAAGGAGGGGAGGCGAGG - Exonic
1188720988 X:33523392-33523414 GAGAAACAGGAGAGGTGATGGGG + Intergenic
1188767402 X:34112439-34112461 GAGATAACGGAGGGGTGGGGGGG - Intergenic
1189102983 X:38210298-38210320 GAGGACAAGGAGGAATAGTGAGG - Intronic
1190035676 X:47021115-47021137 GAGAAGAAGGAGGGGTTCTTGGG - Intronic
1190059312 X:47200828-47200850 GAAAAAATGGAGGGCTGGTGTGG - Intronic
1190061813 X:47216509-47216531 GAGATCCAGGAGTTGTGGTGGGG - Intergenic
1190927874 X:54924836-54924858 GAGTGCAAGGAGGGCAGGTGTGG - Intronic
1191090837 X:56619083-56619105 GAGAAAGACGAGGGGTGGGGTGG + Intergenic
1191870510 X:65741205-65741227 GAGAGCAAGGGGTGGGGGTGTGG - Exonic
1192239071 X:69315156-69315178 GAGAGCAATGTGGGGAGGTGGGG + Intergenic
1192355451 X:70398614-70398636 GAGAACAAGGAAGATTAGTGAGG - Intronic
1193249180 X:79267897-79267919 GTGGAGAAGGAGGTGTGGTGTGG - Intergenic
1194561514 X:95427707-95427729 GAGAAGAAGGAAGAGTGGGGAGG + Intergenic
1195031550 X:100931554-100931576 GAGAAAAATGAGGGTTGGGGAGG - Intergenic
1195122998 X:101775457-101775479 GAGGAGAAGGAAGAGTGGTGAGG - Intergenic
1195245023 X:102987632-102987654 GATAACAAGAAGCTGTGGTGGGG + Intergenic
1196061266 X:111410615-111410637 GAGAAGAAGGAGGGGCTGGGCGG + Intronic
1196686718 X:118516419-118516441 AAGAAAAAGGAGGGGAGGGGAGG - Intronic
1196894485 X:120321546-120321568 GAGAAAAAGGTTGGGTGGAGGGG + Intergenic
1197363250 X:125533111-125533133 GAGGACAAGGAAGAGTGGGGAGG - Intergenic
1197922168 X:131606920-131606942 GAAAATAAGGGGTGGTGGTGGGG - Intergenic
1198073538 X:133172726-133172748 TAGAACAGGGATGGGTGGTAAGG + Intergenic
1198342911 X:135732431-135732453 GGGAACAAAGAGGGCTGGGGTGG - Intergenic
1198345078 X:135750864-135750886 GGGAACAAAGAGGGCTGGGGTGG + Intergenic
1199308730 X:146297879-146297901 GAGAAGAAGGAAGAGTGGGGAGG - Intergenic
1199495325 X:148446513-148446535 GAGAAAAAAGAGGGGAGGAGAGG - Intergenic
1200289195 X:154855756-154855778 AATAACAAAGAGGGGTGGTAGGG - Intronic