ID: 1136500477

View in Genome Browser
Species Human (GRCh38)
Location 16:30667565-30667587
Sequence GCCCCGGGAGCTGCCGTGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136500477_1136500486 13 Left 1136500477 16:30667565-30667587 CCTTTCACGGCAGCTCCCGGGGC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1136500486 16:30667601-30667623 CTGAGCCCCAGCACCCACATTGG 0: 1
1: 0
2: 2
3: 42
4: 316
1136500477_1136500492 26 Left 1136500477 16:30667565-30667587 CCTTTCACGGCAGCTCCCGGGGC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1136500492 16:30667614-30667636 CCCACATTGGTAAGAGCCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1136500477_1136500490 25 Left 1136500477 16:30667565-30667587 CCTTTCACGGCAGCTCCCGGGGC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1136500490 16:30667613-30667635 ACCCACATTGGTAAGAGCCAAGG 0: 1
1: 0
2: 1
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136500477 Original CRISPR GCCCCGGGAGCTGCCGTGAA AGG (reversed) Exonic
900906362 1:5562516-5562538 GCCCCTGCAGCTGCCCTCAAGGG + Intergenic
901837600 1:11934540-11934562 GCCCCGGGAGCTGCACAGAGAGG + Intronic
903795087 1:25922807-25922829 TCCCCGCGAGCTGCCGGGAGGGG - Intergenic
904118653 1:28180544-28180566 GCCCCGGAGGCTGCCCTGTATGG - Intronic
904744659 1:32703193-32703215 TCCCCGGCAGCTGTCGTGAAGGG + Intronic
904822781 1:33256310-33256332 GCCCCGGGGGCTCCCGCGAGTGG - Intergenic
905368944 1:37472524-37472546 GCCCCTGGAGCTGCTGTGCCTGG + Intergenic
906143921 1:43549060-43549082 ACCCCGGGAGCTGTGCTGAAAGG + Intronic
910449035 1:87328656-87328678 GCCCCGGGAGCGGCGGCGGACGG - Exonic
911449206 1:98044244-98044266 CCCCCGGGAGCTTCTGAGAAGGG + Intergenic
915414651 1:155732012-155732034 GCCCCAGGAGTTGCTGGGAAAGG + Exonic
918963336 1:191307159-191307181 GCCCTGGGAGCTGCTGTGATGGG - Intergenic
919751816 1:201042497-201042519 GCCCTGGGCCCTGCCCTGAAGGG - Intronic
919883441 1:201915853-201915875 GTCCCTGGGGCTGCCGTGCAAGG - Intronic
922344246 1:224683048-224683070 TCTCCGGGAGCTTCTGTGAAAGG + Intronic
922834331 1:228618245-228618267 GCACAGGGAGCTGCCAAGAAAGG - Intergenic
922836558 1:228627161-228627183 GCACAGGGAGCTGCCAAGAAAGG - Intergenic
924056210 1:240126973-240126995 GCCCTGGGAGCTGCCTGGAATGG - Intronic
924179167 1:241424125-241424147 GCCCTGGGGGCTGCAGTGATGGG + Intergenic
1063785265 10:9376567-9376589 GCCCTGGAAGCAGCAGTGAAAGG - Intergenic
1065804596 10:29382959-29382981 GCCATGGGAGCTGCTCTGAAAGG + Intergenic
1069327514 10:67249711-67249733 GCACCTGGAGCTGCCATGATAGG - Intronic
1074823239 10:117197229-117197251 GGCCCTGGAGCTGCCTGGAAGGG - Intergenic
1075470287 10:122683688-122683710 GCCCAGGAAGCTGCCCAGAAGGG - Intergenic
1076587514 10:131559670-131559692 GCCCATGGAGCTGCGGTGGAGGG + Intergenic
1076841963 10:133050162-133050184 GCCCCGGAAGCTGGGCTGAATGG - Intergenic
1077059540 11:611799-611821 GCCCGGGGAGCTGTCGGGAGTGG + Exonic
1077059554 11:611838-611860 GCCCGGGGAGCTGTCGGGAGTGG + Exonic
1077059568 11:611877-611899 GCCCGGGGAGCTGTCGGGAGTGG + Exonic
1077488684 11:2850655-2850677 GCTGCGGGAGGGGCCGTGAATGG - Intergenic
1081478504 11:43460933-43460955 GCCCCGGGACTTGCTTTGAAAGG - Intronic
1081858311 11:46317499-46317521 GCCCAGGGAGCTGGCATGACAGG - Intronic
1082982455 11:59136173-59136195 GTCTCGGGAGCTGTCCTGAAAGG + Intergenic
1083289995 11:61684556-61684578 GTCCAGGGAGATGCCGTGGAGGG + Intronic
1083816436 11:65134825-65134847 GCCCCGCGAGCAGCTGGGAAGGG + Intergenic
1085033730 11:73287925-73287947 GCCCAGGGAGCAGCTGTGACAGG - Intronic
1085313864 11:75531615-75531637 GCCCTGCCAGCTGCCCTGAAAGG - Intergenic
1100927396 12:99565311-99565333 GCCCCAGGAGCTGCACTTAATGG - Intronic
1102159722 12:110758621-110758643 GCCCCGGCGGCTGCAGTGATGGG - Intergenic
1103261767 12:119594471-119594493 GCCCCCGGAGCGGCAGGGAAAGG - Intronic
1104067713 12:125319169-125319191 GCCCCGGGAGCTGTAGTCATGGG - Intronic
1105069973 12:133228319-133228341 GCCCATGGAGCTCCCGTGGATGG + Intronic
1106239924 13:27903363-27903385 GCCCTGGGAGATGCCGAGAATGG + Intergenic
1107852356 13:44583250-44583272 GCCTTGGAAGCAGCCGTGAAGGG - Intergenic
1112091644 13:96090307-96090329 GCCCCGCGACCTGCCGGCAAAGG + Intergenic
1112771659 13:102799949-102799971 GACCCGGGTGCTGGCGTGCAGGG - Intronic
1113885497 13:113656583-113656605 GCCCCAGGAGCTGGCGGGAATGG - Intronic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1117899059 14:60514864-60514886 AGCCCGGGGGCGGCCGTGAATGG + Intronic
1118473265 14:66094296-66094318 GCCCTGGGAGCCGCAGTGATGGG - Intergenic
1122138966 14:99650765-99650787 ACCCCAGGAGCTGCTGTGATTGG + Intronic
1122943358 14:104993438-104993460 GCCTGGGCAGCTGTCGTGAACGG + Intronic
1123707997 15:22964535-22964557 CCCCGGGGAGCTGCCGGGCAGGG - Intronic
1124227379 15:27905514-27905536 GCCCTGGGAGGTGCTGTGAGAGG + Intronic
1125606320 15:40941780-40941802 GCCGCGGGAGCTGCGGGGCACGG - Intergenic
1126611237 15:50531702-50531724 GCCCCAGGAGCTGACTTGAAGGG + Intronic
1128454658 15:67825738-67825760 GCCCCGGGGGCTGTTGTTAACGG + Intronic
1129341590 15:74890018-74890040 GCCGCGGGGGCTGCCGGGAAAGG + Exonic
1129476394 15:75786807-75786829 GCACCGGGAGCGGCCGGGGAGGG + Intergenic
1131359365 15:91776378-91776400 GCCCAGAGAGGTGCCGTGATGGG - Intergenic
1133138425 16:3728261-3728283 GCCCATGGAGCTGCCCTGGAGGG + Exonic
1136500477 16:30667565-30667587 GCCCCGGGAGCTGCCGTGAAAGG - Exonic
1136540239 16:30924410-30924432 CCGCCGGGAGCTGCCGAGAAGGG + Intronic
1141154238 16:81585961-81585983 GCCCAGGGCGCTGCCGGGGAAGG + Intronic
1141732109 16:85829786-85829808 GCCCCGGGGGCCACCGTGCAGGG + Intergenic
1141984436 16:87570824-87570846 GCCCTGGGAGCTGCCTTTGAGGG - Intergenic
1142471215 17:164314-164336 GGCCCGGGGGCTTCTGTGAAAGG - Intronic
1143683464 17:8494870-8494892 GCCCAGGCAGCGGCCGTGAATGG + Intronic
1146143502 17:30389120-30389142 GCCCTGGGGGCTGCCGTAATGGG - Intronic
1148206630 17:45783975-45783997 GCCCGGGGAGAAGCCGGGAATGG - Intergenic
1152356492 17:79810107-79810129 GCCCCGGGAGCCGGCGGGGAGGG - Intergenic
1152798788 17:82321670-82321692 GCCCCCGGGGCTGCCGCGGAAGG + Exonic
1159959023 18:74541257-74541279 GCCACAGGAGCTGCCAGGAAAGG + Intronic
1162794301 19:13078664-13078686 GCGCGGGGAGCTGCCCTGAGAGG - Exonic
1163281712 19:16322486-16322508 GCCTGGGCAGCTGCCGGGAAGGG - Intergenic
1165058868 19:33195174-33195196 GCCCCGGGAGCTGGGGACAAAGG + Intronic
1167320791 19:48796211-48796233 GCTCCGGGAGCTCCCAGGAAAGG + Intronic
1167623254 19:50570102-50570124 GCCCTGAGAGCTGCCGAGAGGGG + Intergenic
926625165 2:15085046-15085068 GCCCTGGGGGCTGCTGTGACGGG + Intergenic
926686076 2:15698750-15698772 TCCCAGGGAGCTGTCGAGAAAGG + Intronic
931065519 2:58581708-58581730 GCCCCCTGAGCTGCTGTGATGGG + Intergenic
931671168 2:64649260-64649282 ACCCCAGGAGCTGCAGTGCATGG + Intronic
931859091 2:66334872-66334894 GCCCAGGGAGCTGGCTTCAAAGG - Intergenic
933751146 2:85602673-85602695 GCCCTCGGAGCAGCCCTGAAAGG + Intronic
934584271 2:95476042-95476064 GCCCAGGGAGCTACCTGGAAAGG + Intergenic
934595181 2:95600672-95600694 GCCCAGGGAGCTACCTGGAAAGG - Intergenic
936826934 2:116593229-116593251 TCCCCGGGAGCTGCGGTAGAGGG + Intergenic
941666370 2:168247311-168247333 GCCGCGGGAGCTGCCGGGGCCGG + Exonic
948831069 2:240598525-240598547 GCCCCGGGCGGTGCCTTGAAGGG + Intronic
1169801465 20:9516030-9516052 ACCCGGGGAGCTGAGGTGAAGGG + Exonic
1170617847 20:17968594-17968616 GCCCCGGGAGCAGGCGAGCAGGG + Intronic
1174000472 20:47370960-47370982 GCCCAGAGAGCTGCAGTGCAGGG + Intergenic
1175486852 20:59353121-59353143 GCCCAGTGAGCTGCCGGAAATGG - Intergenic
1178048927 21:28727433-28727455 GCCCAGGCAGCTGCCTGGAAAGG + Intergenic
1181595826 22:23913865-23913887 GTCTCGGGAGCTGCAGGGAAGGG - Intergenic
1183706517 22:39478011-39478033 GCCCCAGGAGCTGCTGTACATGG + Intronic
1185014820 22:48336616-48336638 GCCCTGGGCCCTGCTGTGAATGG - Intergenic
1185077151 22:48689684-48689706 GCCCAGGGAGCTGGGGTGAGTGG - Intronic
950512310 3:13438322-13438344 GTCCCGGGAACTGCCGTGAAGGG + Intergenic
953899910 3:46834069-46834091 GCCCCGGGAGCCGCCGCCAGAGG + Exonic
953901308 3:46845692-46845714 GTCCCGGGAGCTGCGGGGAGAGG + Intergenic
954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG + Intronic
956427908 3:69155644-69155666 CCCCCGGGAGCTGCTTAGAAAGG - Intergenic
956637729 3:71382881-71382903 ACCCCAGGAGATGCCGTCAAAGG - Intronic
958977228 3:100682183-100682205 CCCCCGGGAGCTGCCCTGATGGG + Intronic
962751106 3:138435252-138435274 GCCCCGGGAGCGGTGGGGAACGG - Intronic
964204902 3:154162758-154162780 GCCCCCTGAGCTGCCGAGATAGG + Intronic
967182317 3:186916669-186916691 GCCCTGGCAGGTGCTGTGAATGG - Intergenic
967933003 3:194703947-194703969 GCCCCCGGTGCTTCTGTGAAGGG - Intergenic
968272640 3:197416349-197416371 GTCCCGGGGGCTGCCGAGAATGG + Intergenic
968618727 4:1594020-1594042 GCCCCGGGAGCTGCCCCCAGCGG - Intergenic
968702508 4:2063609-2063631 GCCCCGGGGGCTGCCGGGATTGG + Intronic
969360075 4:6657838-6657860 CAACCTGGAGCTGCCGTGAAAGG + Intergenic
969454987 4:7295515-7295537 GCCCTGGGAGCAGCCGAGAGGGG + Intronic
969677130 4:8620327-8620349 GCCCCGGGATCTTCCAGGAAGGG + Intergenic
969678083 4:8625966-8625988 GCCCCGGGATCTTCCAGGAAGGG + Intergenic
969679038 4:8631603-8631625 GCCCCGGGATCTTCCAGGAAGGG + Intergenic
980242999 4:130201834-130201856 GCCCTGGGGGCTGCTGTGATGGG + Intergenic
981034250 4:140153290-140153312 GCCCCCGCTGCTGCCGCGAATGG - Exonic
982158205 4:152541173-152541195 GCCCTGGGGGCTGCTGTGATGGG - Intergenic
982205613 4:152995403-152995425 TCCCCGGCAGCTGTGGTGAAGGG + Intergenic
991900555 5:71455803-71455825 GCCCCGGCGGCTGCCCGGAAAGG - Exonic
992672051 5:79070338-79070360 GCCCCCAGAGCTGCGGTGCAGGG + Intronic
997955370 5:138274658-138274680 GCCCCGGGAGCCGCCGGGCTTGG + Exonic
1001055304 5:168444606-168444628 GCCCCAGGAGCTGCCCTGCCTGG + Intronic
1003325341 6:5086167-5086189 GCCTCGGGCGCTGAGGTGAAGGG + Exonic
1003544817 6:7051124-7051146 CTCCCGGGAGCCGCCCTGAAGGG + Intergenic
1007207536 6:40164736-40164758 CCCCCGGCAGCTGCAGTGATTGG + Intergenic
1035404182 7:158587564-158587586 GCCCCGGGAGCTGCCGGCCGCGG + Exonic
1035545749 8:481046-481068 GGCCCAGGAGCTGCCCCGAAAGG + Intergenic
1036748628 8:11428759-11428781 GCCCAGGGAGCAGCCGAGCATGG - Intronic
1040323462 8:46329715-46329737 GCCCCGGCAGCTTCTGGGAAGGG + Intergenic
1040342627 8:46448608-46448630 GCCCCGGGGGTTTCCGGGAAGGG + Intergenic
1042577664 8:70238773-70238795 GCACCTGGAGCTGCTGAGAACGG - Intronic
1045348169 8:101313598-101313620 GCCCAGTGAACTGCCATGAAGGG - Intergenic
1047894085 8:129345540-129345562 GCCCAGGATGCTGCCGTGTATGG - Intergenic
1048377332 8:133834140-133834162 GCCCAGGGAGCTGCCGTTGTTGG + Intergenic
1049210481 8:141384291-141384313 CCCCAGGGAGCTGCAGAGAAGGG - Intergenic
1049301585 8:141873480-141873502 AGCCTGGGTGCTGCCGTGAAGGG + Intergenic
1049569092 8:143360016-143360038 GCCGCCGGTGCTGCCGGGAAGGG + Intergenic
1049617489 8:143582052-143582074 CCCCGGGGAGCTGCCGAGATGGG - Intronic
1049732950 8:144188312-144188334 GCCCTGGGAGCAGCAGTGGATGG + Intronic
1052990972 9:34519264-34519286 GCCCAGGGAGCTCCCATGATGGG + Intronic
1053288526 9:36865100-36865122 GAGCAGGGAGCTGCCCTGAATGG - Intronic
1053300685 9:36947169-36947191 GCCTCTGGAGCTGCCAGGAAGGG - Intronic
1059938863 9:119338461-119338483 GTCCCGGGAGAGGCCGTGAGGGG - Intronic
1061188746 9:129070018-129070040 GCCCTGGGAGGTGCCAGGAATGG + Intronic
1061227408 9:129288738-129288760 CCCCAGGGAGCTGCCGGGCAGGG + Intergenic
1061282534 9:129605779-129605801 TCCCAGGGAGCTGCCCTGAGGGG + Intergenic
1061328716 9:129879332-129879354 GCCGCAGGAGCTGCGGTGGATGG - Intronic
1061451180 9:130667691-130667713 GCCTTGGCAGCTCCCGTGAAGGG + Intronic
1061866735 9:133495128-133495150 GCCCCAGGAGCCGCGGTGATGGG + Intergenic
1062012160 9:134273066-134273088 GCCCCGGGCTCTGCCCGGAATGG + Intergenic
1203771913 EBV:53877-53899 GCCCGGGCAGCGGCCGGGAACGG - Intergenic
1188860113 X:35245107-35245129 ACCCTGGGGGCTGCCGTGATGGG - Intergenic
1200152681 X:153958955-153958977 GCCACGGGGGTTGCCGTGCATGG - Intronic