ID: 1136504172 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:30692246-30692268 |
Sequence | CTGGTGAAGTGAAAGTTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1136504172_1136504176 | -3 | Left | 1136504172 | 16:30692246-30692268 | CCATCCAACTTTCACTTCACCAG | No data | ||
Right | 1136504176 | 16:30692266-30692288 | CAGAGTCCCCCTGGTTTAAAAGG | No data | ||||
1136504172_1136504177 | -2 | Left | 1136504172 | 16:30692246-30692268 | CCATCCAACTTTCACTTCACCAG | No data | ||
Right | 1136504177 | 16:30692267-30692289 | AGAGTCCCCCTGGTTTAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1136504172 | Original CRISPR | CTGGTGAAGTGAAAGTTGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |