ID: 1136504172

View in Genome Browser
Species Human (GRCh38)
Location 16:30692246-30692268
Sequence CTGGTGAAGTGAAAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504172_1136504176 -3 Left 1136504172 16:30692246-30692268 CCATCCAACTTTCACTTCACCAG No data
Right 1136504176 16:30692266-30692288 CAGAGTCCCCCTGGTTTAAAAGG No data
1136504172_1136504177 -2 Left 1136504172 16:30692246-30692268 CCATCCAACTTTCACTTCACCAG No data
Right 1136504177 16:30692267-30692289 AGAGTCCCCCTGGTTTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504172 Original CRISPR CTGGTGAAGTGAAAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr