ID: 1136504426

View in Genome Browser
Species Human (GRCh38)
Location 16:30693887-30693909
Sequence ATCAATTGGTGGGGCTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504426_1136504441 10 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504441 16:30693920-30693942 AGAAGTGTCCTGTGGGGAGAGGG No data
1136504426_1136504442 16 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504426_1136504436 2 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504436 16:30693912-30693934 AGGGGGCCAGAAGTGTCCTGTGG No data
1136504426_1136504446 27 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504426_1136504438 4 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504438 16:30693914-30693936 GGGGCCAGAAGTGTCCTGTGGGG No data
1136504426_1136504444 21 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504444 16:30693931-30693953 GTGGGGAGAGGGAGAAGGAAAGG No data
1136504426_1136504437 3 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504437 16:30693913-30693935 GGGGGCCAGAAGTGTCCTGTGGG No data
1136504426_1136504440 9 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504440 16:30693919-30693941 CAGAAGTGTCCTGTGGGGAGAGG No data
1136504426_1136504445 22 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504445 16:30693932-30693954 TGGGGAGAGGGAGAAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504426 Original CRISPR ATCAATTGGTGGGGCTGCTA AGG (reversed) Intergenic