ID: 1136504433

View in Genome Browser
Species Human (GRCh38)
Location 16:30693897-30693919
Sequence GGCCCCCTCCATCAATTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504433_1136504450 29 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504450 16:30693949-30693971 AAAGGGAGTGGCCAGGGAGGTGG No data
1136504433_1136504437 -7 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504437 16:30693913-30693935 GGGGGCCAGAAGTGTCCTGTGGG No data
1136504433_1136504438 -6 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504438 16:30693914-30693936 GGGGCCAGAAGTGTCCTGTGGGG No data
1136504433_1136504441 0 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504441 16:30693920-30693942 AGAAGTGTCCTGTGGGGAGAGGG No data
1136504433_1136504448 23 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504448 16:30693943-30693965 AGAAGGAAAGGGAGTGGCCAGGG No data
1136504433_1136504442 6 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504433_1136504451 30 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504451 16:30693950-30693972 AAGGGAGTGGCCAGGGAGGTGGG No data
1136504433_1136504436 -8 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504436 16:30693912-30693934 AGGGGGCCAGAAGTGTCCTGTGG No data
1136504433_1136504444 11 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504444 16:30693931-30693953 GTGGGGAGAGGGAGAAGGAAAGG No data
1136504433_1136504447 22 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504447 16:30693942-30693964 GAGAAGGAAAGGGAGTGGCCAGG No data
1136504433_1136504446 17 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504433_1136504440 -1 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504440 16:30693919-30693941 CAGAAGTGTCCTGTGGGGAGAGG No data
1136504433_1136504449 26 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504433_1136504445 12 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504445 16:30693932-30693954 TGGGGAGAGGGAGAAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504433 Original CRISPR GGCCCCCTCCATCAATTGGT GGG (reversed) Intergenic
No off target data available for this crispr