ID: 1136504435

View in Genome Browser
Species Human (GRCh38)
Location 16:30693901-30693923
Sequence TTCTGGCCCCCTCCATCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504435_1136504448 19 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504448 16:30693943-30693965 AGAAGGAAAGGGAGTGGCCAGGG No data
1136504435_1136504447 18 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504447 16:30693942-30693964 GAGAAGGAAAGGGAGTGGCCAGG No data
1136504435_1136504444 7 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504444 16:30693931-30693953 GTGGGGAGAGGGAGAAGGAAAGG No data
1136504435_1136504451 26 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504451 16:30693950-30693972 AAGGGAGTGGCCAGGGAGGTGGG No data
1136504435_1136504441 -4 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504441 16:30693920-30693942 AGAAGTGTCCTGTGGGGAGAGGG No data
1136504435_1136504445 8 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504445 16:30693932-30693954 TGGGGAGAGGGAGAAGGAAAGGG No data
1136504435_1136504440 -5 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504440 16:30693919-30693941 CAGAAGTGTCCTGTGGGGAGAGG No data
1136504435_1136504449 22 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504435_1136504450 25 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504450 16:30693949-30693971 AAAGGGAGTGGCCAGGGAGGTGG No data
1136504435_1136504438 -10 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504438 16:30693914-30693936 GGGGCCAGAAGTGTCCTGTGGGG No data
1136504435_1136504452 29 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504452 16:30693953-30693975 GGAGTGGCCAGGGAGGTGGGAGG No data
1136504435_1136504442 2 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504435_1136504446 13 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504435 Original CRISPR TTCTGGCCCCCTCCATCAAT TGG (reversed) Intergenic
No off target data available for this crispr