ID: 1136504436

View in Genome Browser
Species Human (GRCh38)
Location 16:30693912-30693934
Sequence AGGGGGCCAGAAGTGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504426_1136504436 2 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504436 16:30693912-30693934 AGGGGGCCAGAAGTGTCCTGTGG No data
1136504434_1136504436 -9 Left 1136504434 16:30693898-30693920 CCACCAATTGATGGAGGGGGCCA No data
Right 1136504436 16:30693912-30693934 AGGGGGCCAGAAGTGTCCTGTGG No data
1136504432_1136504436 -7 Left 1136504432 16:30693896-30693918 CCCCACCAATTGATGGAGGGGGC No data
Right 1136504436 16:30693912-30693934 AGGGGGCCAGAAGTGTCCTGTGG No data
1136504433_1136504436 -8 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504436 16:30693912-30693934 AGGGGGCCAGAAGTGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504436 Original CRISPR AGGGGGCCAGAAGTGTCCTG TGG Intergenic
No off target data available for this crispr