ID: 1136504437

View in Genome Browser
Species Human (GRCh38)
Location 16:30693913-30693935
Sequence GGGGGCCAGAAGTGTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504433_1136504437 -7 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504437 16:30693913-30693935 GGGGGCCAGAAGTGTCCTGTGGG No data
1136504426_1136504437 3 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504437 16:30693913-30693935 GGGGGCCAGAAGTGTCCTGTGGG No data
1136504434_1136504437 -8 Left 1136504434 16:30693898-30693920 CCACCAATTGATGGAGGGGGCCA No data
Right 1136504437 16:30693913-30693935 GGGGGCCAGAAGTGTCCTGTGGG No data
1136504432_1136504437 -6 Left 1136504432 16:30693896-30693918 CCCCACCAATTGATGGAGGGGGC No data
Right 1136504437 16:30693913-30693935 GGGGGCCAGAAGTGTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504437 Original CRISPR GGGGGCCAGAAGTGTCCTGT GGG Intergenic
No off target data available for this crispr