ID: 1136504439

View in Genome Browser
Species Human (GRCh38)
Location 16:30693918-30693940
Sequence CTCTCCCCACAGGACACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504439_1136504448 2 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504448 16:30693943-30693965 AGAAGGAAAGGGAGTGGCCAGGG No data
1136504439_1136504454 19 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504454 16:30693960-30693982 CCAGGGAGGTGGGAGGAGCCTGG No data
1136504439_1136504445 -9 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504445 16:30693932-30693954 TGGGGAGAGGGAGAAGGAAAGGG No data
1136504439_1136504450 8 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504450 16:30693949-30693971 AAAGGGAGTGGCCAGGGAGGTGG No data
1136504439_1136504449 5 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504439_1136504446 -4 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504439_1136504455 20 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504455 16:30693961-30693983 CAGGGAGGTGGGAGGAGCCTGGG No data
1136504439_1136504444 -10 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504444 16:30693931-30693953 GTGGGGAGAGGGAGAAGGAAAGG No data
1136504439_1136504451 9 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504451 16:30693950-30693972 AAGGGAGTGGCCAGGGAGGTGGG No data
1136504439_1136504452 12 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504452 16:30693953-30693975 GGAGTGGCCAGGGAGGTGGGAGG No data
1136504439_1136504456 29 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504456 16:30693970-30693992 GGGAGGAGCCTGGGAAAGACTGG No data
1136504439_1136504447 1 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504447 16:30693942-30693964 GAGAAGGAAAGGGAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504439 Original CRISPR CTCTCCCCACAGGACACTTC TGG (reversed) Intergenic
No off target data available for this crispr