ID: 1136504442

View in Genome Browser
Species Human (GRCh38)
Location 16:30693926-30693948
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504433_1136504442 6 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504426_1136504442 16 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504434_1136504442 5 Left 1136504434 16:30693898-30693920 CCACCAATTGATGGAGGGGGCCA No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504435_1136504442 2 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data
1136504432_1136504442 7 Left 1136504432 16:30693896-30693918 CCCCACCAATTGATGGAGGGGGC No data
Right 1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504442 Original CRISPR GTCCTGTGGGGAGAGGGAGA AGG Intergenic
No off target data available for this crispr