ID: 1136504443

View in Genome Browser
Species Human (GRCh38)
Location 16:30693928-30693950
Sequence TTCCTTCTCCCTCTCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504443_1136504455 10 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504455 16:30693961-30693983 CAGGGAGGTGGGAGGAGCCTGGG No data
1136504443_1136504456 19 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504456 16:30693970-30693992 GGGAGGAGCCTGGGAAAGACTGG No data
1136504443_1136504451 -1 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504451 16:30693950-30693972 AAGGGAGTGGCCAGGGAGGTGGG No data
1136504443_1136504452 2 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504452 16:30693953-30693975 GGAGTGGCCAGGGAGGTGGGAGG No data
1136504443_1136504450 -2 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504450 16:30693949-30693971 AAAGGGAGTGGCCAGGGAGGTGG No data
1136504443_1136504448 -8 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504448 16:30693943-30693965 AGAAGGAAAGGGAGTGGCCAGGG No data
1136504443_1136504454 9 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504454 16:30693960-30693982 CCAGGGAGGTGGGAGGAGCCTGG No data
1136504443_1136504449 -5 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504443_1136504447 -9 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504447 16:30693942-30693964 GAGAAGGAAAGGGAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504443 Original CRISPR TTCCTTCTCCCTCTCCCCAC AGG (reversed) Intergenic