ID: 1136504446

View in Genome Browser
Species Human (GRCh38)
Location 16:30693937-30693959
Sequence AGAGGGAGAAGGAAAGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504435_1136504446 13 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504432_1136504446 18 Left 1136504432 16:30693896-30693918 CCCCACCAATTGATGGAGGGGGC No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504439_1136504446 -4 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504433_1136504446 17 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504426_1136504446 27 Left 1136504426 16:30693887-30693909 CCTTAGCAGCCCCACCAATTGAT No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data
1136504434_1136504446 16 Left 1136504434 16:30693898-30693920 CCACCAATTGATGGAGGGGGCCA No data
Right 1136504446 16:30693937-30693959 AGAGGGAGAAGGAAAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504446 Original CRISPR AGAGGGAGAAGGAAAGGGAG TGG Intergenic
No off target data available for this crispr