ID: 1136504449

View in Genome Browser
Species Human (GRCh38)
Location 16:30693946-30693968
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504433_1136504449 26 Left 1136504433 16:30693897-30693919 CCCACCAATTGATGGAGGGGGCC No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504435_1136504449 22 Left 1136504435 16:30693901-30693923 CCAATTGATGGAGGGGGCCAGAA No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504443_1136504449 -5 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504439_1136504449 5 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504434_1136504449 25 Left 1136504434 16:30693898-30693920 CCACCAATTGATGGAGGGGGCCA No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data
1136504432_1136504449 27 Left 1136504432 16:30693896-30693918 CCCCACCAATTGATGGAGGGGGC No data
Right 1136504449 16:30693946-30693968 AGGAAAGGGAGTGGCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504449 Original CRISPR AGGAAAGGGAGTGGCCAGGG AGG Intergenic
No off target data available for this crispr