ID: 1136504454

View in Genome Browser
Species Human (GRCh38)
Location 16:30693960-30693982
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504443_1136504454 9 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504454 16:30693960-30693982 CCAGGGAGGTGGGAGGAGCCTGG No data
1136504439_1136504454 19 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504454 16:30693960-30693982 CCAGGGAGGTGGGAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504454 Original CRISPR CCAGGGAGGTGGGAGGAGCC TGG Intergenic
No off target data available for this crispr