ID: 1136504455

View in Genome Browser
Species Human (GRCh38)
Location 16:30693961-30693983
Sequence CAGGGAGGTGGGAGGAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136504439_1136504455 20 Left 1136504439 16:30693918-30693940 CCAGAAGTGTCCTGTGGGGAGAG No data
Right 1136504455 16:30693961-30693983 CAGGGAGGTGGGAGGAGCCTGGG No data
1136504443_1136504455 10 Left 1136504443 16:30693928-30693950 CCTGTGGGGAGAGGGAGAAGGAA No data
Right 1136504455 16:30693961-30693983 CAGGGAGGTGGGAGGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136504455 Original CRISPR CAGGGAGGTGGGAGGAGCCT GGG Intergenic
No off target data available for this crispr