ID: 1136505464

View in Genome Browser
Species Human (GRCh38)
Location 16:30699917-30699939
Sequence CCTTCAGTACGGCGGCACCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136505464 Original CRISPR CCTTCAGTACGGCGGCACCG TGG Exonic
906152536 1:43595991-43596013 CCTTCTCTACAGCGGCACTGAGG - Intronic
907261324 1:53220658-53220680 CCCTCAGTAGGGCGGGGCCGGGG + Intergenic
910936407 1:92486595-92486617 GCTCCAGGCCGGCGGCACCGCGG - Intronic
912945564 1:114081310-114081332 CCTTCAGTAAGGGAGCACTGAGG + Intergenic
917731076 1:177875666-177875688 CCTTCAGCAGGGTGGCACTGGGG - Intergenic
1062796622 10:349349-349371 CCTTCAGGACGGCGACCACGTGG - Exonic
1090808784 11:130219333-130219355 CTTTCGGTACGGGGGCACCAAGG + Intergenic
1119098219 14:71854172-71854194 CCTTTAGTACGGGGGAAGCGGGG - Intergenic
1136255275 16:29034760-29034782 CCTTCTGCACGGTGTCACCGCGG - Intergenic
1136505464 16:30699917-30699939 CCTTCAGTACGGCGGCACCGTGG + Exonic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1142177626 16:88652237-88652259 CCTTCAGCCCTGCTGCACCGAGG + Exonic
1145280191 17:21462455-21462477 CCCTCCGCACAGCGGCACCGCGG + Intergenic
925610402 2:5696858-5696880 CCTTCGTTGCGGCGGCCCCGGGG - Exonic
926311273 2:11677787-11677809 CCATCAGTACGCGGGCACCTGGG - Intronic
1175855727 20:62119922-62119944 CCTTCAGTCCGGGGGCTCAGAGG + Intergenic
1183931316 22:41237685-41237707 CCTGCAGCACTGCGGCATCGCGG - Exonic
962738862 3:138348657-138348679 CCGTCAGTCCGGCGGCCGCGGGG + Intronic
972715770 4:41644538-41644560 CCTGCTGTGCGGCTGCACCGCGG - Exonic
984699021 4:182806738-182806760 GCTTCAGCACCGCCGCACCGAGG + Intergenic
994710579 5:103259366-103259388 ACTTCCGCACCGCGGCACCGCGG - Intronic
1019716935 7:2543462-2543484 CCTGCAGTGAAGCGGCACCGGGG - Intronic
1032074495 7:128830169-128830191 CTTCCAGCGCGGCGGCACCGGGG + Intergenic
1034446046 7:151114881-151114903 CCTGCAGGGCGGCGGCAGCGCGG - Intronic
1037821807 8:22138755-22138777 CCTGCAGGACAGCGACACCGAGG - Exonic
1052358624 9:27529853-27529875 CCTGCGGTATGGCAGCACCGTGG + Intergenic
1056918997 9:90769639-90769661 TCCTCAGAACGGCGGCACTGAGG + Intergenic