ID: 1136506795

View in Genome Browser
Species Human (GRCh38)
Location 16:30709639-30709661
Sequence CCTGCTTTGCTGGAGGTTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136506795_1136506799 -5 Left 1136506795 16:30709639-30709661 CCATTAACCTCCAGCAAAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1136506799 16:30709657-30709679 GCAGGCTCTTCCCCTTGCCTCGG 0: 1
1: 0
2: 3
3: 32
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136506795 Original CRISPR CCTGCTTTGCTGGAGGTTAA TGG (reversed) Exonic
905311883 1:37054886-37054908 CTTGCTTTTCTGGAGGTTGCGGG + Intergenic
905314863 1:37075847-37075869 GCAGCATTGCTGGAGGTGAAAGG + Intergenic
905738090 1:40344713-40344735 CATGATTTGCTGGAGGATTATGG + Intergenic
907789447 1:57647583-57647605 CCTGCTTGGGTTAAGGTTAAGGG - Intronic
908877926 1:68698917-68698939 CCAGCTATGCTGGAGGCTGAGGG + Intergenic
908967100 1:69778528-69778550 CCTGCTTTGCTTGGGGATCAGGG + Intronic
909141523 1:71872517-71872539 TATGCTTTGCTGGAGGGAAAAGG - Intronic
910218924 1:84870343-84870365 CCTGCTTTGCTGGAGTGGAACGG - Intronic
910736271 1:90461379-90461401 CCTGCTTTGAGGGAGGTAAGAGG - Intergenic
912376317 1:109212751-109212773 CCCCCTTTCCTGGAGGTTGAAGG + Intergenic
914936761 1:151988547-151988569 CATACTTTTCTGGAGATTAAGGG - Intronic
914985823 1:152456280-152456302 CCTGCATTGCTTCAGGTTCATGG + Intergenic
917873501 1:179263928-179263950 CCTGGTTTGCTGGAGACTGAGGG - Intergenic
918052762 1:180989157-180989179 ACTGCTTTTGTGTAGGTTAAGGG - Intronic
918308489 1:183268269-183268291 CCTGCCTTGCTGGATTTAAAGGG + Intronic
919362333 1:196610726-196610748 CCTGGGATGCTGGAGGTTAGAGG + Intergenic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
920914755 1:210251186-210251208 CCTTATTTGCTCGAGGTTTATGG + Intergenic
921788515 1:219262720-219262742 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
921916684 1:220620054-220620076 CATGTTTTGATGGAAGTTAAGGG + Intronic
923632444 1:235660343-235660365 CCTGCACTCCTGGAGGTTACAGG - Intergenic
1063472046 10:6295799-6295821 CCTCCTCTGCTGGAAGTTAGAGG + Intergenic
1068173113 10:53421936-53421958 CCTGCTCTGGTGGAGGTAAAAGG + Intergenic
1068808584 10:61228497-61228519 CCTGCTTTGGTGGAGTATCAGGG - Intergenic
1069791577 10:71026114-71026136 CCTGTTATTCTGGAAGTTAATGG + Intergenic
1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG + Intergenic
1071235864 10:83647337-83647359 CCTGCTGTGCTGGAGGGCCAGGG - Intergenic
1071717375 10:88110909-88110931 CCTGCTTTGCTGGCAGTACATGG - Intergenic
1072381704 10:94879273-94879295 CCTGCTCTGGTGGAGGTTGCAGG + Intergenic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1078687794 11:13549228-13549250 CCTGCTCTGATGGAGGTTACAGG + Intergenic
1080007345 11:27424163-27424185 CTGGTTTTGCTGGAGGTTAGAGG - Intronic
1080244331 11:30162906-30162928 CCTGCTTTGGGGCAGGTGAAGGG - Intergenic
1083039879 11:59675747-59675769 CCTGCTTTGGGGTAGGTGAAAGG - Intergenic
1083054684 11:59808631-59808653 CCTGCCTCTCTGGATGTTAATGG + Intronic
1083736777 11:64686010-64686032 CCTGCGTTGCTGGAGGGGAGAGG - Intronic
1084680577 11:70664037-70664059 CCAGGCCTGCTGGAGGTTAATGG - Intronic
1086155501 11:83661111-83661133 CCTGCTTTGCCCGAGGTTAGTGG + Intronic
1087356175 11:97097459-97097481 CCTGCTCTGGTGCAGGGTAAGGG + Intergenic
1088717410 11:112560968-112560990 CCTGCTGTGCTGGTGATTACCGG - Intergenic
1088776434 11:113088847-113088869 CTTGTTTTGCTGGAGTTTAATGG + Intronic
1089092862 11:115892755-115892777 CCCACTTTGCTGGAGATGAATGG + Intergenic
1089464113 11:118672986-118673008 TCTGCTTTTCTGGAAGTTAAAGG - Intronic
1092255685 12:6925829-6925851 CCAGTCTTGCTGGAGGCTAAGGG - Intronic
1093469129 12:19482293-19482315 CCTGCTCTGCTGGAGGTGGCAGG + Intronic
1094699507 12:32855216-32855238 CCCCCATTGCTGGATGTTAATGG - Intronic
1095638519 12:44459334-44459356 CCTGGTTTACTGCAGTTTAATGG + Intergenic
1098705235 12:73678647-73678669 CCTGATTAGATGGAGGTTATGGG - Intergenic
1098899894 12:76101904-76101926 TCTGCTTTGCTGTAGGGGAAGGG - Intergenic
1101122730 12:101599840-101599862 CATGCTGTGCTGGAGATTCATGG + Intronic
1103889835 12:124230100-124230122 GCTGGTCTGCTGGAGGGTAAGGG + Intronic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1105816801 13:24043601-24043623 CATGCTTTTCTGGAGAGTAAAGG + Intronic
1106976634 13:35225497-35225519 CCTTCATTGCTCCAGGTTAAAGG - Intronic
1107206720 13:37799278-37799300 CATGCATTGCTAGAGGCTAAGGG - Intronic
1107361224 13:39619412-39619434 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1112032907 13:95473746-95473768 CCTGCTATGCTGCTGGTTCAGGG + Intronic
1112087048 13:96042128-96042150 CCTGCTCTGCTGGAGGTGGCAGG - Intronic
1112502078 13:99950578-99950600 CCTGATTTTCTGGAGTTTCATGG - Intergenic
1112644091 13:101309929-101309951 CATGCTCTTCTGGAAGTTAATGG + Intronic
1113161672 13:107388793-107388815 CCTGCCGTGGTGCAGGTTAAAGG - Intronic
1114621952 14:24101391-24101413 CCTTCTCTGCTGGAGGTTGCTGG - Intronic
1114692799 14:24600816-24600838 CATGCTTTGTGGGAGGCTAAGGG - Intergenic
1114694266 14:24612107-24612129 CCTGCTCTGGTGGAGGTGGAAGG + Intergenic
1116082901 14:40199124-40199146 CCTGCATTGCTGGAGGTCTAGGG - Intergenic
1117442178 14:55770343-55770365 CATGCTGTGCTGGAGCTGAAAGG + Intergenic
1117652152 14:57918287-57918309 CATGAATTGCTGGAGGTTCAGGG - Intronic
1118890948 14:69908487-69908509 GCTGCTGTGCTGGAGGGTAGTGG + Intronic
1119585622 14:75832227-75832249 GCTGCTATGCTGGAGGAGAAGGG + Intronic
1121097511 14:91228108-91228130 CCTCCTATGCAAGAGGTTAAAGG - Intergenic
1121262220 14:92574724-92574746 CCTGCTCTGCTGGAGGAGAGGGG + Intronic
1122625205 14:103081886-103081908 GCTGATTGGATGGAGGTTAAGGG + Intergenic
1123121724 14:105919840-105919862 CCTGCATTGCTGGAGGGACAGGG - Intronic
1123404429 15:20011491-20011513 CCTGCATTGCTGGAGGGACAGGG - Intergenic
1123513762 15:21018138-21018160 CCTGCATTGCTGGAGGGACAGGG - Intergenic
1125135181 15:36333012-36333034 GCTGCATGGCTGGAGGTGAACGG + Intergenic
1125619614 15:41048266-41048288 CTTACTTTGCAGGTGGTTAAGGG - Exonic
1127014530 15:54668824-54668846 CCTGCTCTGGTGGAGGTAGAAGG - Intergenic
1128637910 15:69314890-69314912 CCTGCTTTGGGGGAGCTGAAGGG + Intronic
1129062056 15:72868034-72868056 CATTCCTTGCTGGAGGTTCAAGG + Intergenic
1129245698 15:74277460-74277482 CCTCCATGGCTGGGGGTTAATGG + Intronic
1135988694 16:27203829-27203851 CCTGCCCTGCGGGAGGATAAAGG + Intronic
1136506795 16:30709639-30709661 CCTGCTTTGCTGGAGGTTAATGG - Exonic
1138124420 16:54427067-54427089 CCTGCTTTGGGGGATATTAAGGG + Intergenic
1143240537 17:5439599-5439621 CCTGCTTTGGGGCAGGTAAAAGG - Intronic
1143872155 17:9964764-9964786 CCTGCGTTGATGGAGTTTTATGG - Intronic
1144487899 17:15682729-15682751 CCTGCCTTTCTGAAGGATAAGGG - Intronic
1146172913 17:30646721-30646743 TCCGCTTTCCTGGAGGTTTAGGG - Intergenic
1146346368 17:32062706-32062728 TCCGCTTTCCTGGAGGTTTAGGG - Intergenic
1149133111 17:53331722-53331744 GATGTTTTGCTGGAGGTTAGAGG - Intergenic
1149887630 17:60356409-60356431 CCTGCTTGTGTGGAGGTTTAAGG - Intronic
1150666759 17:67147431-67147453 CCTGCTTTGGGGCAGGTGAAAGG - Intronic
1151665476 17:75543035-75543057 TCTGCTTAGCTGGAGTTTCATGG + Intronic
1153451301 18:5232588-5232610 CCTGCTCTGGTGGAGGTAAGAGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155084865 18:22448321-22448343 CCTGATTTGCTGGGGACTAAGGG + Intergenic
1156326725 18:36080193-36080215 CCTGCTCTGGTGGAGGTGATAGG - Intergenic
1156869970 18:41934056-41934078 ACTGCTTTGCTGGAGGGTTGGGG + Intergenic
1158022413 18:52858849-52858871 CTTGCTTTTCTGGAGTTTCAGGG + Intronic
1161773555 19:6244302-6244324 CATTCTTTGCTGGAGTTTCATGG - Intronic
1162886305 19:13700015-13700037 CATGCTCTGCTGGAGATGAAAGG - Intergenic
1162989514 19:14293375-14293397 TCCGCTTTCCTGGAGGTTTAGGG + Intergenic
1163642436 19:18469326-18469348 GCTGTTTTGCTGCTGGTTAATGG + Intronic
1164559908 19:29283619-29283641 TCTGCCTTGCGGGAGGTTTATGG - Intergenic
1165915200 19:39254355-39254377 CCTGCTTTCCTGGTGGGTCACGG + Intergenic
1166776344 19:45315283-45315305 CCTGCTGTGTTGGAGATTCAGGG - Intronic
926342378 2:11914429-11914451 CCTGCTTTGGGGAAGGTAAAGGG + Intergenic
928176781 2:29039379-29039401 CCTGCTAAACTGGAGGTCAAGGG + Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
930469641 2:51795779-51795801 CCTGCTCTGCTGGAGGTAGCAGG - Intergenic
932689686 2:73901503-73901525 CCTGCTGAGCTGGGGGTTAGGGG + Intronic
938564189 2:132503456-132503478 CCTGCTTTGATGGAGGTAGCAGG + Intronic
938996441 2:136683568-136683590 CCTGCTTTGGTGGAGGTAGCAGG - Intergenic
939219398 2:139282025-139282047 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
940752073 2:157637211-157637233 CCCATTTTGCTGGATGTTAAAGG - Intergenic
941060676 2:160843191-160843213 CCTGCTTTGGTGGAGGTAGCAGG - Intergenic
941684162 2:168430456-168430478 CCAGCTTTGCTGAAGGTTTAGGG + Intergenic
942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG + Intergenic
944357069 2:198803231-198803253 CCTCCTTTCCTACAGGTTAAGGG + Intergenic
947416508 2:229901918-229901940 CCTGCTTCCTGGGAGGTTAAAGG - Intronic
947457023 2:230264859-230264881 CCTGTTCTGCTGGAGGTGAAGGG + Intronic
947537628 2:230950778-230950800 CCTGCCTTGCGGCAGGTGAAAGG - Intronic
948009768 2:234642195-234642217 GCTCCTTTCCTGGAAGTTAAGGG + Intergenic
1169316264 20:4593095-4593117 CCTGCTGGGCTAGAGGTAAAGGG - Intergenic
1170141182 20:13126369-13126391 CCTGCTTTGCTGTAGATTCTAGG + Intronic
1171002652 20:21430241-21430263 GATGAATTGCTGGAGGTTAAAGG - Intergenic
1176305730 21:5122193-5122215 CCTGCTTTGGGGCAGGTAAAGGG - Intronic
1178044062 21:28674532-28674554 CCTGCTTCTCTGGAGTTAAATGG + Intergenic
1178967320 21:37133657-37133679 CCTGCTCTGCTGGAGCTTTCAGG + Intronic
1179601390 21:42479986-42480008 CCTGCTTTGCTCCAGCTAAAAGG - Intronic
1179851327 21:44139838-44139860 CCTGCTTTGGGGCAGGTAAAGGG + Intronic
1180018254 21:45101569-45101591 CCTCCTGTACTGGAGTTTAAAGG + Intronic
1180039917 21:45270655-45270677 CCTGCTCTGCTGGAGGTGGCGGG - Intronic
1181275138 22:21683333-21683355 CCCGCTTTCCTGGAGGTCAGGGG + Intronic
1185039407 22:48496767-48496789 CCTGGTTTCCTGGGGGTTAACGG + Intronic
950599156 3:14016829-14016851 CCTGCTGTGGTGGAGGTTTCAGG + Intronic
951260588 3:20503584-20503606 CCTGCTCTGGTGGAGGTTGCAGG + Intergenic
952082928 3:29782286-29782308 CCTGCTTTGGTGGAGGTAGCAGG - Intronic
953409266 3:42680545-42680567 CCTGCTTTCAGGGAGGATAATGG - Intergenic
956429045 3:69166007-69166029 CCTGCTTTCCTGAAGCTTACAGG - Intergenic
956597105 3:70979536-70979558 CCTACTTTGCTGAAGTTTATTGG - Intronic
956656539 3:71558293-71558315 CCAGCTTTCCCTGAGGTTAATGG - Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
960153014 3:114270530-114270552 CCTGCTTTGGTGGAGGTAGCTGG + Intergenic
961535296 3:127567003-127567025 TCTGCTTGGCTGGAGGCGAATGG - Intergenic
961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG + Intergenic
964157369 3:153602514-153602536 CCTACTTTGCTTGAGGTGAAGGG - Intergenic
967209332 3:187153117-187153139 CCTCCTTTGCTGTAGCTTAGAGG - Intronic
968121645 3:196130123-196130145 CCTGCCTTTCTGGAGGTTCTGGG + Intergenic
968668801 4:1836772-1836794 CCTGCTTTTCTGGAGGCTGCTGG - Intronic
969325377 4:6441099-6441121 CCTGCAGAGCTGGAGGTTACTGG - Intronic
970258752 4:14200224-14200246 ACTGTTTTGCTGGCAGTTAAAGG - Intergenic
971524464 4:27599107-27599129 CCTGCTTTGAGGTAGGATAAGGG + Intergenic
972806516 4:42533777-42533799 CCTGCTTTGGTGGAGGTAGCAGG - Intronic
973278305 4:48333151-48333173 CCAGCTTTCCTGGAGCTTCATGG + Intergenic
973841029 4:54860746-54860768 CCTGCCTTGCTGCAAGCTAATGG - Intergenic
973920157 4:55675928-55675950 CCTGCTCTGGTGGAGGTAACAGG - Intergenic
974080844 4:57211055-57211077 CCTGGTTTGCTGGAGGATCTAGG + Intergenic
977369509 4:96117372-96117394 CCTGTTTTACTGAAGTTTAAGGG + Intergenic
977416939 4:96744957-96744979 CCTGCTTAGCTTGTGGTTAATGG + Intergenic
979419556 4:120487205-120487227 CCTGCTTTTCTGGACTTTACAGG + Intergenic
982106614 4:152016827-152016849 CCTGCTTTTCTAGAGGACAATGG + Intergenic
983807894 4:172017891-172017913 CCTGCTCTGCTAGAGGTTGCAGG + Intronic
984190558 4:176600880-176600902 CCTGCTTTGGTGGAGGTAGCAGG + Intergenic
984960312 4:185091042-185091064 CATGCTCTGCTGGAGTTTCACGG - Intergenic
988344662 5:30021379-30021401 CCTGTTTTGGTGGAGGTGATGGG - Intergenic
988674120 5:33413628-33413650 GCAGCTTTGCTGAAGGTGAAAGG + Intergenic
988889563 5:35599844-35599866 CCTGCTCTGGTGGAGGTTAGAGG - Intergenic
989525956 5:42454182-42454204 CCTGCTCTGGTGGAGGTGACAGG + Intronic
990207959 5:53450616-53450638 ACTGCTATGCTGGAGGTGGAGGG - Intergenic
992665684 5:79006792-79006814 GCTGCTTCTCTGGAGGTTAAGGG - Intronic
993796615 5:92275470-92275492 CCTGCTTTGATGGAGGTGGCAGG - Intergenic
995095820 5:108234562-108234584 TCTACTTCTCTGGAGGTTAAAGG - Intronic
996141281 5:119912894-119912916 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
996428719 5:123345371-123345393 TCTGCTTTGATGGAAGTTATTGG + Exonic
999677138 5:154015379-154015401 CCTGTTTTGCTGGAGGTGTCGGG - Intronic
1002369234 5:178737607-178737629 CTTGCTGTGCAGGAGGTTTAAGG - Intergenic
1003476204 6:6486003-6486025 TCTGTTTTGGTGGAGGTTATAGG - Intergenic
1006582484 6:35084898-35084920 CATGCTTTGTTGCAGGTTAGAGG - Intronic
1007878985 6:45140657-45140679 CCTGCTGTGCTGGAGGTGGCAGG - Intronic
1010545384 6:77148963-77148985 GCTGCATTGCTGGTGGTAAATGG + Intergenic
1014238461 6:118988497-118988519 CCCACTTTGCTGTAGGTTCACGG + Intronic
1022799461 7:33761838-33761860 CCCGCTGTGCTGGAGGCAAATGG + Intergenic
1023031083 7:36091071-36091093 CCTGCTCTGCTGTGGGTAAATGG + Intergenic
1023152276 7:37213365-37213387 CCTGTCTTCCAGGAGGTTAAAGG + Exonic
1023657559 7:42440603-42440625 CCTGCTCTGCTGGAGGTAGCAGG + Intergenic
1025807502 7:64849327-64849349 CCTGCTTTGGTGGAGGTAGCAGG + Intergenic
1028978823 7:96944350-96944372 GCTGCTTTTCTTGAGGTTTAGGG + Intergenic
1030082424 7:105789341-105789363 TCTGCTCTCCTGGAGCTTAAGGG + Intronic
1032408517 7:131675269-131675291 CCAGCTCTGCTGCAGGTTCAGGG + Intergenic
1032872026 7:135996350-135996372 CCTCCAATGCTGGAGGATAAAGG + Intergenic
1033505440 7:141995129-141995151 CCTCCTTGCCTGGAGCTTAAAGG - Intronic
1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG + Intergenic
1034061243 7:148092542-148092564 CCTGCCCTGCTGGGGGTTAGAGG + Intronic
1034417775 7:150974344-150974366 CGTGCGTGGATGGAGGTTAAAGG - Intronic
1035017305 7:155778156-155778178 CCTGCCTTGCTGGAGGAGATGGG + Exonic
1040867945 8:52069860-52069882 CCTGCTTTGATGGAGGTGGCAGG + Intergenic
1041057366 8:54000734-54000756 CCAGCTTTGCTGGTTGGTAATGG - Intronic
1042333456 8:67606679-67606701 CCTGCTTTGGTGGTGGAGAAAGG + Intronic
1042735257 8:71980468-71980490 CCTGCTTTGCAGGATTTTATGGG + Intronic
1043117624 8:76278918-76278940 CCTACTTTCCTGGAGGTTGTTGG + Intergenic
1045306465 8:100960977-100960999 CCTGTTTTGCTGGGGGTTGGAGG - Intergenic
1047937449 8:129796776-129796798 CCTGCTCTGGTGGAGGTAACAGG + Intergenic
1048311034 8:133322784-133322806 CCAGTTTTGTTGGAGGTCAAAGG - Intergenic
1049210934 8:141386129-141386151 CCTGCATTGGTGGGGGTGAAAGG + Intergenic
1049635773 8:143688367-143688389 CCTGCTGTGCTGGAGGTGGGAGG + Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1051844560 9:21436918-21436940 CCAGCCATGATGGAGGTTAAGGG - Intronic
1057231333 9:93323420-93323442 CCTGCCTTCCAGGTGGTTAAGGG + Intronic
1057236761 9:93367203-93367225 CCTGCCTTCCAGGTGGTTAAGGG - Intergenic
1058155166 9:101506755-101506777 CCAGCTTTAATGGATGTTAAGGG - Intronic
1060409971 9:123393907-123393929 CTTGCTTTGCCGGAGGACAATGG + Intronic
1061198604 9:129122861-129122883 CCAGCTTTTCTGGAGGGTAGGGG + Intronic
1061240047 9:129364717-129364739 CCTGCTTTGCTCCAGGTTCTGGG - Intergenic
1062519710 9:136952574-136952596 CCTCCTCTGCTGGAGGTCAGGGG - Intronic
1187048168 X:15669713-15669735 CTTGCTTTATTGGAGGTGAATGG - Intergenic
1188045845 X:25425828-25425850 CCTGTTCTGGTGGAGGTTGAGGG + Intergenic
1189907071 X:45772158-45772180 CTGACTTTGCTGAAGGTTAAAGG - Intergenic
1192629026 X:72760721-72760743 CCTGCTATGCTGCAGCTTGACGG - Intergenic
1192652684 X:72960093-72960115 CCTGCTATGCTGCAGCTTGACGG + Intergenic
1192869393 X:75171967-75171989 CCTGCTCTGGTGGAGGTGACAGG + Intergenic
1193204804 X:78736122-78736144 CCTGGGTTGTTGGTGGTTAATGG - Intergenic
1193954589 X:87844200-87844222 CCTGCTTTCATGGAGGTGACAGG + Intergenic
1194121596 X:89970598-89970620 CATGTTTTGGGGGAGGTTAAAGG - Intergenic
1195757396 X:108212920-108212942 CTTGCTTTGCTGGATTTTCATGG + Intronic
1196041595 X:111210876-111210898 CCTGGTTTGCTTGAGATTGAGGG + Intronic
1198518629 X:137430924-137430946 GCTGCTTGGCTGGGAGTTAAAGG + Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1199282882 X:146022569-146022591 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1199396279 X:147342434-147342456 CCTGTTCTCCTGGAGCTTAAAGG + Intergenic
1200837905 Y:7750803-7750825 CCTGGGTTGCTGGTGGTTACTGG + Intergenic
1201315848 Y:12644464-12644486 CCTGTTCTGCTGGAGGTTGCAGG - Intergenic