ID: 1136507317

View in Genome Browser
Species Human (GRCh38)
Location 16:30713060-30713082
Sequence ATGGAGCGACAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 951
Summary {0: 1, 1: 0, 2: 6, 3: 80, 4: 864}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136507317_1136507324 29 Left 1136507317 16:30713060-30713082 CCCTCCTCTTTCTGTCGCTCCAT 0: 1
1: 0
2: 6
3: 80
4: 864
Right 1136507324 16:30713112-30713134 AACCTGATTACTGTCCTTTGAGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136507317 Original CRISPR ATGGAGCGACAGAAAGAGGA GGG (reversed) Intronic
900035354 1:403180-403202 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
900056974 1:638929-638951 GTGGAGGGACAGAAAGAAGTAGG + Intergenic
900084966 1:888512-888534 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
900084985 1:888599-888621 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
900569540 1:3351567-3351589 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
900695596 1:4007844-4007866 AGGGAGAGACAGAAATAGGGAGG + Intergenic
900767002 1:4512524-4512546 ATGAAGAGACAGAAAGAGATGGG + Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900918548 1:5656138-5656160 AGGGATGGAGAGAAAGAGGAAGG + Intergenic
900993149 1:6107055-6107077 ATGGAGCGATGGAAGGATGATGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901395879 1:8981300-8981322 AGGGAGGGACAGAAAGGGAAGGG - Intergenic
902502726 1:16921781-16921803 AGGGAGCCAAAGGAAGAGGAAGG - Intronic
903197740 1:21705024-21705046 AGGGAGGGAGAGAAAGAGGAGGG + Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905323168 1:37131895-37131917 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
905362367 1:37429783-37429805 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
905869560 1:41395277-41395299 ATGGAGTGAGAGAAAGAGAAAGG + Intergenic
905893414 1:41530839-41530861 ATGGAGAGAGAGAGATAGGAAGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907255029 1:53172790-53172812 ATGGAGCAAGGGAAAGAGGGAGG - Intergenic
907508093 1:54936616-54936638 ATAGAATGAAAGAAAGAGGAAGG - Intergenic
907977390 1:59445133-59445155 AAGGAGGGAGAGAAAGAGGGAGG + Intronic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908721546 1:67131614-67131636 ATGGTGGAACAGAAAGGGGAAGG - Intronic
909005051 1:70265888-70265910 ATGGAGGGAGGGAAAGAGGACGG + Intronic
909550365 1:76893216-76893238 AAGGAAGGAAAGAAAGAGGAAGG + Intronic
909721729 1:78778674-78778696 AAAGAGCGCCAGACAGAGGAAGG - Intergenic
910023018 1:82615818-82615840 ATAGAGCGTGAGAAAGTGGAGGG - Intergenic
910032490 1:82745732-82745754 AGGGAGAGAAAGGAAGAGGAGGG - Intergenic
910144585 1:84064892-84064914 ATGGAGGGAAAGAGAGAAGAGGG - Intergenic
910499392 1:87872111-87872133 ATGAAGGGAAAGAGAGAGGATGG - Intergenic
910540486 1:88350489-88350511 AAAGAGGGAAAGAAAGAGGAGGG + Intergenic
910713073 1:90202004-90202026 AGGAAGAGAGAGAAAGAGGAGGG + Intergenic
910735039 1:90444356-90444378 AAGGAAGGAGAGAAAGAGGAAGG + Intergenic
911247209 1:95531713-95531735 AGAGAGAGAAAGAAAGAGGAGGG + Intergenic
911256268 1:95637074-95637096 ATGCAGGGACAGGAAGAGCATGG - Intergenic
911382378 1:97130914-97130936 ATAGAGAGAGAGAAAGAGGGAGG - Intronic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911629816 1:100170680-100170702 ATGGAGGGAGGGAAGGAGGAAGG - Intronic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
915132820 1:153707701-153707723 AAAAAGAGACAGAAAGAGGAAGG + Intergenic
915222438 1:154385695-154385717 GTGGAGCTCCAGGAAGAGGATGG + Intergenic
915661284 1:157407743-157407765 AGGGAGCAAGAGAGAGAGGAGGG + Intergenic
915738818 1:158102356-158102378 ATGGAGGGAAGGAAAGAGGGAGG + Intergenic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
917309361 1:173662549-173662571 ATGGAGTGATAGAAAGAGGTTGG - Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919058852 1:192605950-192605972 ATAGAGAGAAAGAAAGAAGAGGG + Intergenic
919856797 1:201711653-201711675 AGGGAGTGACAGAAAGATGATGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920867494 1:209765212-209765234 AGGGAGAGAGAGAGAGAGGAAGG + Intronic
920905830 1:210166577-210166599 AAGGAGGGAGAGAGAGAGGAAGG + Intronic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921266924 1:213428513-213428535 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
921732399 1:218593069-218593091 AGGGAGCAAGAGAGAGAGGATGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922139292 1:222866191-222866213 AGGGAGTGACAGAAAGAAAATGG - Intergenic
922257888 1:223908739-223908761 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
923329285 1:232907834-232907856 ATGGAGAGAAAGAAAGAGAGAGG - Intergenic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
924339085 1:243011514-243011536 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1062773400 10:123639-123661 ATGGAGGGAAGGAAGGAGGAAGG + Intergenic
1062928399 10:1335424-1335446 ATGGAGGGAGAAATAGAGGAAGG + Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063153408 10:3356495-3356517 ATGGGGCTAGAGAACGAGGAAGG - Intergenic
1063164303 10:3446032-3446054 ATGGATGCAAAGAAAGAGGAGGG + Intergenic
1063250935 10:4273819-4273841 ATGGAGCGAAAAACAGAGGAGGG + Intergenic
1063647449 10:7899228-7899250 ATGGAGGGACCGAATGAGAACGG - Intronic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063876465 10:10484152-10484174 AGGGAGGGAGAGAGAGAGGAGGG - Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1064356533 10:14623891-14623913 ATTGAGCGACAGAAAAATTAAGG - Intronic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065299591 10:24309171-24309193 AAGGAGGGAGAGAGAGAGGAAGG + Intronic
1065478362 10:26165500-26165522 ATCGAGGGAAGGAAAGAGGAAGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066148401 10:32587395-32587417 AGAGAGCAACAGAGAGAGGAAGG + Intronic
1066420099 10:35257235-35257257 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1067292598 10:44955089-44955111 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1067311288 10:45115891-45115913 ATGGAGAGAAAGAGAGTGGAAGG - Intergenic
1067513711 10:46918009-46918031 AAGGAGGGAGAGAAAGAGGGAGG - Intronic
1067648542 10:48133825-48133847 AAGGAGGGAGAGAAAGAGGGAGG + Intergenic
1067807555 10:49403807-49403829 AGGGAGGGAGAGAAAGAGAAAGG - Intergenic
1067807565 10:49403871-49403893 AGGGAGGGAGAGAAAGAGAAAGG - Intergenic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068099443 10:52533089-52533111 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1068147861 10:53093940-53093962 CAGGAGCGAGAGAGAGAGGAGGG - Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068972881 10:62977719-62977741 ATAGAGAGAGAGAGAGAGGAAGG + Intergenic
1069323154 10:67199002-67199024 AAGGAAGGAGAGAAAGAGGAGGG + Intronic
1069817976 10:71210556-71210578 AAGGAGAGAGAGAAAGAGGTTGG + Intergenic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070363624 10:75714822-75714844 AGGGAGGGAAAGAAGGAGGAAGG - Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070574995 10:77671000-77671022 AGGGAGAGACAGAAAGAGAGAGG + Intergenic
1070651518 10:78240245-78240267 ATGGAGGGAGAGAAAGAGAGGGG - Intergenic
1070982529 10:80660910-80660932 TTGTTGCAACAGAAAGAGGAAGG - Intergenic
1070985170 10:80683075-80683097 ATGGAGCAAAAGAAAGTTGAGGG - Intergenic
1071453270 10:85819952-85819974 AGGGAGAGAAAGAGAGAGGAAGG + Intronic
1071771714 10:88736129-88736151 ATGGAGCCAGGGAAAAAGGAAGG + Intronic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1073679702 10:105689332-105689354 ATAGAGGGAGAGAAAGAGGAAGG - Intergenic
1073801936 10:107051003-107051025 AAGGAGGGAGAGAAAAAGGAAGG - Intronic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074724117 10:116289866-116289888 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075348671 10:121704287-121704309 GTGGAGGGAGAGAAAGAGAAGGG + Intergenic
1075807575 10:125201291-125201313 ACAGAGTGAGAGAAAGAGGAAGG + Intergenic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1076230137 10:128813434-128813456 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076476455 10:130757033-130757055 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1076558736 10:131347125-131347147 AAGGAATGAGAGAAAGAGGAAGG - Intergenic
1077166469 11:1142017-1142039 ATGGGAGGAGAGAAAGAGGATGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077573443 11:3357815-3357837 AAGGAGGGAGAGAAAGAGAAAGG + Intronic
1077923226 11:6656254-6656276 ATGGGGCGAGAAGAAGAGGATGG - Intergenic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078384127 11:10872788-10872810 AAAGAACGAAAGAAAGAGGAAGG - Intergenic
1079623457 11:22584271-22584293 AGGGAGCAAGAGAAAGAGGCAGG - Intergenic
1080142674 11:28941591-28941613 AGGGGGCAAGAGAAAGAGGATGG + Intergenic
1080165000 11:29225388-29225410 AAGAAGAGACAGAAAGAGGTGGG - Intergenic
1080210629 11:29781110-29781132 AAGGGGCTACAGAAACAGGAAGG + Intergenic
1080397878 11:31906596-31906618 AGGGAGAGACAGAAAGAGAAGGG + Intronic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083213247 11:61202550-61202572 AAGGAGCAAAAGAAAGAGAAGGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1085623733 11:78056420-78056442 AGGGAATGACAGAAAGAGGAAGG - Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086515198 11:87603940-87603962 ATGGAGCCCAAGACAGAGGAGGG + Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1087924570 11:103904366-103904388 ATGGGTCTACAGAAAGAGTAGGG - Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1088582748 11:111331371-111331393 ATGGGGCCATAGAAAGAGGAGGG - Intergenic
1089051046 11:115546261-115546283 TGGGAGAGAAAGAAAGAGGATGG - Intergenic
1090066211 11:123505841-123505863 AGGGAGAGAAAGAAAGAAGAAGG - Intergenic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090904744 11:131065467-131065489 ATGGAGGGAGAGAGAGAGGGAGG - Intergenic
1090981142 11:131723536-131723558 ATGGAAGGAAAGAAAAAGGAAGG - Intronic
1091141733 11:133241050-133241072 ATTCATCGAGAGAAAGAGGAAGG - Intronic
1092084084 12:5741480-5741502 AAGGAGCGGTAGGAAGAGGAGGG - Intronic
1092759211 12:11794169-11794191 ATGGAGAGAGAGAAAGAGAGAGG - Intronic
1092780122 12:11978555-11978577 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1093261002 12:16937910-16937932 CTGGACCTACAGAAAGAGGCAGG - Intergenic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1093828325 12:23723065-23723087 ATGCAGCCAGAAAAAGAGGAGGG - Intronic
1094064787 12:26350953-26350975 ATAGAGCCACAGAGAGAAGAGGG + Intronic
1094387274 12:29908926-29908948 AATGAGAGACAGAAAGAGAAAGG - Intergenic
1095339359 12:41070106-41070128 ATGGAGCCGCAGAAATTGGAAGG - Exonic
1095650596 12:44604268-44604290 AAGGAGTGAGAGAAAGGGGAAGG + Intronic
1095992804 12:48049083-48049105 ATGGAGCGAAGTAAAGAGAAGGG - Exonic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096267458 12:50135130-50135152 AGGGAGGGAGAGAGAGAGGAGGG + Intronic
1096267485 12:50135232-50135254 AGGGAGGGAGAGAGAGAGGAGGG + Intronic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1097787142 12:63773283-63773305 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098263489 12:68695572-68695594 ATGTAGGGACAGAAAGTAGATGG + Intronic
1098460766 12:70730810-70730832 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1098469371 12:70826103-70826125 ATGGAGAGAGGGAAAGAAGAAGG + Intronic
1098725280 12:73956956-73956978 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1100111358 12:91245668-91245690 ATGGGGGGACAGGTAGAGGAAGG - Intergenic
1100370679 12:93966621-93966643 ATGGAGGGATGGAAAGAGGGAGG - Intergenic
1100370703 12:93966701-93966723 ATGGAGGGATGGAAAGAGGGAGG - Intergenic
1100370726 12:93966780-93966802 ATAGAGGGATAGAAAGAGAAAGG - Intergenic
1100370745 12:93966855-93966877 ATAGAGGGATAGAAAGAGAAAGG - Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101877839 12:108607173-108607195 AGGGGGAGAGAGAAAGAGGAGGG - Intergenic
1101916958 12:108903272-108903294 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1102052990 12:109876650-109876672 AAGGAAGGAAAGAAAGAGGAAGG + Intronic
1102764796 12:115423224-115423246 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1102986060 12:117279669-117279691 ATGGAGCGAGAGGAAGAGGTTGG + Intronic
1103038219 12:117673445-117673467 ATGGACAGATGGAAAGAGGAAGG + Intronic
1103524139 12:121556394-121556416 AGGGAGCAAGAGAGAGAGGAGGG - Intronic
1104280552 12:127372654-127372676 ATGGAATGAGAGAAAGAGGGAGG + Intergenic
1104611487 12:130232128-130232150 AGGGTGAGACAGAAAGAGCAAGG - Intergenic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1105069017 12:133222695-133222717 ATGCAGGGCCAGAAAGAAGAAGG - Intronic
1105782086 13:23714527-23714549 ATGGAGGGCAAGAAAGAGGGTGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1107037482 13:35916617-35916639 ATAGAGGGAGAGAAAAAGGAAGG - Intronic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107792057 13:44012497-44012519 ATGGAGAGAGAGAAAGAGAGAGG - Intergenic
1107865884 13:44702998-44703020 AGGGAGAGAGAGAGAGAGGAAGG - Intergenic
1108179828 13:47829510-47829532 ATGGAGCGGCAGAAAAGGCAAGG - Intergenic
1108368530 13:49743273-49743295 ATGGAGCAATAGAGAGAGCAAGG + Intronic
1108379139 13:49840120-49840142 ATGGAGGGAGAGAACAAGGAAGG + Intergenic
1108419144 13:50230939-50230961 ATGGAACGAAGGAAAGAAGAAGG + Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108581703 13:51833613-51833635 TGTGAGGGACAGAAAGAGGAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109747275 13:66641704-66641726 ATGAAGGGACAGATAGATGATGG + Intronic
1109812619 13:67534688-67534710 AGAAAGCGAAAGAAAGAGGAAGG + Intergenic
1109837987 13:67883756-67883778 AGGGAGCAACAGAGAGAGGAGGG - Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110646946 13:77897610-77897632 AGGGAGTAACAGAAAGAGCAAGG - Exonic
1111135962 13:84043834-84043856 ATTTAGCTAGAGAAAGAGGATGG + Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111659286 13:91189498-91189520 ATGGAGTAACAGAGAGAGAAAGG + Intergenic
1111670271 13:91321112-91321134 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1111786277 13:92790677-92790699 AGGGAGGGAAAGACAGAGGAAGG + Intronic
1112038183 13:95517115-95517137 AGGGAGAGAAAGAAAGAGAAAGG - Intronic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112752869 13:102599456-102599478 ATGGATAGAAAGAAAAAGGAAGG + Intronic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113127662 13:106998104-106998126 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1113348941 13:109509057-109509079 AAGGAAGGAAAGAAAGAGGAGGG + Intergenic
1113387822 13:109866758-109866780 AGGGAGGGAAAGAAGGAGGAAGG + Intergenic
1113695244 13:112341600-112341622 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1113990449 14:16023969-16023991 AGGGAGGGAAAGAAAAAGGAAGG - Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116189397 14:41644728-41644750 ATGGAGCGACTGAAAGTTGGAGG - Intronic
1116763111 14:49039065-49039087 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1118089570 14:62458225-62458247 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1118422330 14:65620678-65620700 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1120090790 14:80331227-80331249 AAGGAGTGAATGAAAGAGGAAGG - Intronic
1120473150 14:84952162-84952184 AAGGAGGGAAAGAAATAGGATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122550623 14:102547254-102547276 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
1122662698 14:103308717-103308739 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1123678637 15:22739458-22739480 AGGGAGGGAGAGAAAGAAGAGGG - Intergenic
1124330843 15:28813739-28813761 AGGGAGGGAGAGAAAGAAGAGGG - Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124486406 15:30121148-30121170 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1124541480 15:30590127-30590149 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1124618440 15:31259862-31259884 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1124757178 15:32417458-32417480 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1126224157 15:46250460-46250482 AGAGAGAGACAGAGAGAGGAGGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126510194 15:49462685-49462707 ATTGAATGAGAGAAAGAGGAAGG - Intronic
1126658573 15:51008303-51008325 AGGGAGCAAGAGAGAGAGGAGGG + Intergenic
1127500446 15:59549595-59549617 AGGGAGCCACAGAAACAAGAGGG + Intergenic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1127959798 15:63882329-63882351 AAGGAGGGAAAGAAAAAGGAAGG + Intergenic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128408576 15:67369464-67369486 AAGGAGGGAAAGAGAGAGGAAGG + Intronic
1128436275 15:67652439-67652461 GTGGAGCAAGAGAGAGAGGAGGG + Intronic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1129255429 15:74331453-74331475 ATGGGGCGCCTGAATGAGGAGGG - Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130028221 15:80288334-80288356 AGAGAGAGAGAGAAAGAGGAGGG + Intergenic
1130748565 15:86684093-86684115 ATGGAGGGAAGGAAAGAGGGAGG + Intronic
1130864158 15:87917753-87917775 AGGGAGCAAGAGAGAGAGGAAGG - Intronic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131312583 15:91304412-91304434 AGAGAGGGAGAGAAAGAGGAAGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133421492 16:5650694-5650716 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133875910 16:9734143-9734165 AGGAAGGGAAAGAAAGAGGAAGG + Intergenic
1133927348 16:10203906-10203928 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1134019472 16:10911464-10911486 ATGGAAAGAAAGAAAGAGAAAGG - Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134338547 16:13324044-13324066 AGGGAGCAAGAGAGAGAGGAAGG - Intergenic
1134429975 16:14194343-14194365 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135186110 16:20317074-20317096 AGGGAGGGACAGGAAGAGAAGGG - Intronic
1135619653 16:23944933-23944955 AATGAGGGACAGAGAGAGGAGGG + Intronic
1135637934 16:24094938-24094960 AAGGAGGGACAGAAGGAGGGAGG + Intronic
1136178563 16:28535282-28535304 AAGGAGGGAAAGAAAGAGGAAGG - Intronic
1136279577 16:29200181-29200203 ATGGAGGGAGGGAAAGAGGGAGG - Intergenic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1137367489 16:47873402-47873424 ACAGAGAGAAAGAAAGAGGAAGG - Intergenic
1137393817 16:48103030-48103052 ATGGAGCTACAGAAAGGTCAGGG - Intronic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1138723764 16:59113140-59113162 ATGGAGAGAAAGAAATATGATGG - Intergenic
1138818243 16:60227485-60227507 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1139189649 16:64847309-64847331 GTGGAGGGACAAAGAGAGGAAGG - Intergenic
1139209965 16:65067778-65067800 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1140018690 16:71215280-71215302 AAGGAGGGAGGGAAAGAGGAAGG + Intronic
1140264950 16:73412515-73412537 ATGGAGGGAAAGGAAGGGGAGGG - Intergenic
1140887137 16:79254250-79254272 ATGTAGAGAGAGAAAGAGGCAGG - Intergenic
1140914711 16:79483189-79483211 AAGGAGGGACAGAAGGAGGGAGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1142083969 16:88166282-88166304 ATGGAGGGAAGGAAAGAGGGAGG - Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143091282 17:4450350-4450372 AGGGAGAGAGAGAGAGAGGAGGG - Intronic
1143182546 17:4992673-4992695 AAGGAGAGAAAGAAAGAGAATGG - Intronic
1143701140 17:8661045-8661067 AAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144239219 17:13293643-13293665 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144465520 17:15493732-15493754 AGGGAGGGAGAGAGAGAGGAAGG - Intronic
1144465533 17:15493786-15493808 AGGGAGGGAGAGAGAGAGGAGGG - Intronic
1144576336 17:16432043-16432065 ATGGAGGGACAGGAGGACGAGGG + Exonic
1144695295 17:17300442-17300464 ATAGATCCACAGAAATAGGATGG + Intergenic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146180371 17:30694198-30694220 ATGGAGGGAAAGGAAGGGGACGG - Intergenic
1146348440 17:32076199-32076221 AAGGAGCAAGAGAAAGAGCAGGG - Intergenic
1146429808 17:32781680-32781702 AAGGAGAGAAATAAAGAGGAAGG + Intronic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1146820874 17:35982917-35982939 ATGGATGGAGAGAAAGAGGGAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147447581 17:40484209-40484231 ATGGTGGGAGAGAAGGAGGAGGG - Intronic
1147598410 17:41731560-41731582 CTGGAGGGAGACAAAGAGGAAGG + Intronic
1148330851 17:46813126-46813148 ATGGAGCCACAGAAAGAAACGGG + Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1149515283 17:57276539-57276561 ATGCAGAGAAAGATAGAGGAGGG + Intronic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1149686696 17:58539738-58539760 AGGGAGGGAGAGAGAGAGGAGGG + Intronic
1150015356 17:61551682-61551704 AGAGAGGGAAAGAAAGAGGAAGG - Intergenic
1150465187 17:65386637-65386659 AGGGAGAGAGAAAAAGAGGAAGG - Intergenic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645740 17:66976499-66976521 ATGGAGGGAGGGAAAGAGGGAGG - Intronic
1150914018 17:69417786-69417808 AGGGAGGGAGAGAAAGAGGGAGG + Intronic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1151956575 17:77383141-77383163 AGGGAGGGAAAGAAAGAGGGAGG - Intronic
1151956579 17:77383157-77383179 AGGGAGGGAGAGAAAGAGGGAGG - Intronic
1151978240 17:77494327-77494349 ATGAAGGGACAGAGAGAGGAAGG - Intronic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152844830 17:82593366-82593388 AGGGAGGGAGGGAAAGAGGAAGG + Intronic
1153151448 18:2099423-2099445 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1153179195 18:2413688-2413710 ATGAATCGACACAAACAGGATGG + Intergenic
1153354500 18:4120765-4120787 AGGGAGAGAGAGAAAGAGAAAGG - Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153751882 18:8240596-8240618 ATGGAGAGAGAGAGAGAGGGAGG + Intronic
1153908397 18:9684699-9684721 AAGGAGGGAGAGAGAGAGGAAGG - Intergenic
1154124143 18:11674633-11674655 GTGGAGCAAGAGAAAGAGAAAGG + Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1156107711 18:33685756-33685778 AGGGAGCAAGAGAGAGAGGAAGG + Intronic
1156127240 18:33921096-33921118 ATGGTGGGACAGACATAGGATGG - Intronic
1156523591 18:37744145-37744167 AGGGAGGGAGAGAAAGAGGAAGG - Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157317323 18:46603254-46603276 ATAGAGAGAGAGAAAGAGCAAGG + Intronic
1157971443 18:52274200-52274222 ATGGAGCTCCAGAGAGTGGAAGG - Intergenic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158768012 18:60479082-60479104 AGGGAGCAAGAGAGAGAGGAAGG + Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159072118 18:63636865-63636887 ATGGAGAGAAAGAAAGAGCCTGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1160074434 18:75658763-75658785 AGGGAGTGAGAGAGAGAGGAAGG + Intergenic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1161142953 19:2659631-2659653 AGGGAGGGAAGGAAAGAGGAAGG + Intronic
1161660285 19:5541590-5541612 ATGGGGTGAGAGAGAGAGGAGGG + Intergenic
1161756591 19:6138498-6138520 AGGGAGGGAGGGAAAGAGGAAGG + Intronic
1161789275 19:6349358-6349380 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1161905180 19:7151229-7151251 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1162104564 19:8362545-8362567 AATGAGGGAGAGAAAGAGGAAGG + Intronic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162448806 19:10741913-10741935 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1162751190 19:12830392-12830414 AGGGAGCGAGAGAGGGAGGAGGG - Intronic
1162872719 19:13598583-13598605 AGGGAGGGAAAGAAAGAGGAAGG + Intronic
1162978229 19:14221339-14221361 ATGGAGGGAAAGGAAGGGGACGG + Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163712028 19:18852646-18852668 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163712036 19:18852670-18852692 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1164654330 19:29909960-29909982 AAGGAGGGACGGAGAGAGGAGGG - Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1166350478 19:42195658-42195680 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1166473509 19:43100392-43100414 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167234412 19:48305187-48305209 ATGGAGTGAGAGAGAGAGCATGG + Intronic
1167552391 19:50170026-50170048 AGGGAGGGACAGACAGAGGGAGG - Intergenic
1167640744 19:50679988-50680010 ATGGAGAGACAGAGAGACAATGG + Intronic
1167762107 19:51456262-51456284 ATGGATCCAGAGAAAGAGGAAGG + Intronic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1168254931 19:55159967-55159989 ATTGAGCGGCAGGAAGTGGACGG + Exonic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925221973 2:2149084-2149106 AAGGAGGGAAAGAAAGAGAAGGG - Intronic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925606937 2:5669266-5669288 AGGGAGGGAGAGAAAGAGGGAGG + Intergenic
925659188 2:6184325-6184347 AGGGAAGGAAAGAAAGAGGAAGG + Intergenic
925887212 2:8403213-8403235 ATAGAGAGAGAGAGAGAGGAGGG - Intergenic
925965692 2:9063112-9063134 AGGAAGAGAGAGAAAGAGGAAGG + Intergenic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926438024 2:12857305-12857327 ATTGAGAGAGAGAAAGAGGCAGG - Intergenic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926457670 2:13088080-13088102 ATGGACTGAAAGAAAGAGGAAGG - Intergenic
926668703 2:15553769-15553791 AGGGAGAGAGAGAAAGAGGGAGG - Intronic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927347542 2:22063720-22063742 ATGGAGGGAGAGAGAAAGGAGGG - Intergenic
927434740 2:23057474-23057496 AGGGAGGGACAGAGAGAGGGAGG + Intergenic
927845858 2:26472666-26472688 ATGGACAGACAGGCAGAGGAAGG + Intronic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928742656 2:34373242-34373264 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
931077147 2:58728324-58728346 AGGGAGAGAGAGAAAGAGAAAGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932336128 2:70932464-70932486 ATGGATCGACAGACAGAGAATGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933906334 2:86897360-86897382 ATGGAGCGACAAAGACTGGATGG + Intergenic
934325233 2:92007697-92007719 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935776212 2:106474397-106474419 ATGGAGCGACAAAGACTGGATGG - Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
935951131 2:108329892-108329914 ATAGAGTAACAGAAAGAGCATGG - Intergenic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936233626 2:110725152-110725174 AAGGAGGGAAGGAAAGAGGAAGG + Intergenic
936523303 2:113226093-113226115 AGGGAGGGAGAGAAAGAGGGAGG - Intronic
936644619 2:114354724-114354746 AGGGAGCTACAGAAAGAGGAGGG + Intergenic
937311340 2:120905218-120905240 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
937339593 2:121082635-121082657 ATGGAGAGACAGGGAGAGGCAGG + Intergenic
938590562 2:132732057-132732079 ATAGAGAGACAGAGAGAGAAGGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939506054 2:143048453-143048475 AGAGAGAGAGAGAAAGAGGAGGG - Exonic
940015077 2:149095746-149095768 AGGGAGAGAGAGAAAGAGGCAGG + Intronic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940280771 2:151987378-151987400 ATGGAGAGAGAGAAACAGAATGG - Intronic
941268920 2:163400818-163400840 ATAGAGAGAGAGAAAGAGAAGGG - Intergenic
941479249 2:165985379-165985401 ATGGAAGGAAAGAAAAAGGAAGG + Intergenic
941479254 2:165985415-165985437 ATGGAAGGAAAGAAAAAGGAAGG + Intergenic
941520674 2:166537944-166537966 ATGGAGAGAGAGAGAGAGCATGG - Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
942187177 2:173435007-173435029 ATGGAGCGAGCGAAAGAACAAGG - Intergenic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942385652 2:175439770-175439792 AGGGAGTGACAGAAAGAACATGG + Intergenic
942404378 2:175637841-175637863 ATGGAGTGCCAGAAAGACTAGGG - Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
944331288 2:198469378-198469400 AGGGAGCAAGAGAAAGAAGAGGG + Intronic
944849693 2:203705797-203705819 ATGGAAAGAAAGAAAGAGGGAGG - Intergenic
945284253 2:208066226-208066248 ATGTAGCGACAGAAAGTGTGAGG + Intergenic
945860859 2:215120534-215120556 ATGGAGCGTAAGAAAGAAGTGGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946528629 2:220547446-220547468 ATGGAGGGAAAGGGAGAGGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947266161 2:228284458-228284480 GAGGAGGGACAGAAAGAGTAGGG - Intergenic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
948255670 2:236566883-236566905 AGGGAGAGACAGAGAGAGAAAGG - Intergenic
948570868 2:238916426-238916448 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
949086314 2:242158737-242158759 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1168749331 20:271056-271078 AGGGAGGGAAAGAAAGAGGGAGG + Exonic
1168826756 20:819327-819349 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1168955229 20:1829865-1829887 GAGGGGCGACAGCAAGAGGAAGG + Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169277824 20:4245433-4245455 AGGCAGGGAGAGAAAGAGGAAGG + Intronic
1169544300 20:6635162-6635184 ATGGAGGGAGGGAGAGAGGAAGG - Intergenic
1169564709 20:6841348-6841370 AGGGAGAGAGAGAGAGAGGAGGG + Intergenic
1169660998 20:7978239-7978261 ATGAAGTGAGAGAAAGAAGAGGG - Exonic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169933895 20:10862731-10862753 ACGGAGAGAAAGAAAGAGTAAGG - Intergenic
1170039570 20:12025735-12025757 AGGTAGAGACAGAAAGAGAAAGG - Intergenic
1170148091 20:13199390-13199412 ATGGAGGGAGGGAAGGAGGACGG - Intergenic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1170503240 20:16996554-16996576 ATGGAGGGAAGGAAAGAGGATGG - Intergenic
1171000101 20:21405812-21405834 AGGAAGCGAGAGAGAGAGGAGGG - Intergenic
1171012054 20:21514149-21514171 AGGGAGGGAAAGAAAGAGGGAGG + Intergenic
1171096368 20:22336037-22336059 AGGGAGGGACAGAGAGAGGCAGG - Intergenic
1171354544 20:24534055-24534077 GGGGAGCAAGAGAAAGAGGAGGG + Intronic
1171816559 20:29790627-29790649 AGGGAGGGAGAGAAAGAAGAAGG - Intergenic
1171901796 20:30865364-30865386 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172970807 20:38871683-38871705 AGGGAGGGAAAGAAAGGGGAAGG + Intronic
1173033432 20:39383741-39383763 ATGGAGGGATTGAAAGAGAATGG + Intergenic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174785118 20:53425159-53425181 ATGCAGGGATAGAAAGAGGGTGG - Intronic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177930506 21:27277126-27277148 ATGGAGAGAGAGAGAGAGGGAGG + Intergenic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178724929 21:35042852-35042874 TTGCAGTGACAGAAAGAGTAAGG - Intronic
1178775128 21:35542644-35542666 ATAGAGGGACAGAAAGACCAAGG + Intronic
1178789590 21:35687735-35687757 ATGGAGGGACAGATAGGAGAAGG - Intronic
1179358304 21:40682626-40682648 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
1179361631 21:40714584-40714606 ATGGTGAGACAGGAACAGGATGG - Intronic
1179560268 21:42211461-42211483 AGGTAGAGACAGAGAGAGGAAGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179623659 21:42634811-42634833 ATGGATGGAGAGAAAGATGATGG - Intergenic
1180058994 21:45375129-45375151 AAGGACAGACAGAAAGAGGTCGG + Intergenic
1180316822 22:11283557-11283579 AGGGAGGGAAAGAAAAAGGAAGG + Intergenic
1180320021 22:11311221-11311243 AGGGAGGGAGAGAAAGAAGAAGG - Intergenic
1180320038 22:11311348-11311370 ATGGAGGGAGAGAAAGATGGAGG - Intergenic
1180335169 22:11571306-11571328 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1181963282 22:26638402-26638424 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1182126078 22:27816799-27816821 AAGGAGGGAAAGAGAGAGGAAGG - Intergenic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182468392 22:30532175-30532197 ATGGACAGACACAAAGAGGTCGG - Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183299054 22:37049593-37049615 AGGGAGGGAAAGAAAGAGGGAGG - Intergenic
1183627824 22:39015414-39015436 ACGGGGAGAGAGAAAGAGGAGGG - Intronic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1183746469 22:39694753-39694775 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1184117340 22:42429923-42429945 ATGGAGTGACAGATAGATGAAGG + Intronic
1184744868 22:46450331-46450353 ATGGAGGGACAGACAGGGCAGGG + Intronic
1184934718 22:47712894-47712916 ATGGAGAGACAGAAAATGCAAGG - Intergenic
1184955990 22:47886251-47886273 AAGGGGCGACAGCAAGGGGATGG + Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
949620094 3:5801094-5801116 AGGGAGGGAGAAAAAGAGGAAGG - Intergenic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
950582134 3:13869488-13869510 AGGGAGGGAAAGAGAGAGGAAGG + Intronic
950871283 3:16231753-16231775 AGGGAGGGAGAGAGAGAGGAAGG - Intronic
951289421 3:20856347-20856369 AGAGAGGGAAAGAAAGAGGAAGG - Intergenic
951760975 3:26147178-26147200 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952155769 3:30641910-30641932 ATGTAGGGAGAGAGAGAGGAAGG - Intronic
952506262 3:34009174-34009196 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953721178 3:45356542-45356564 TCCAAGCGACAGAAAGAGGAAGG + Intergenic
953852213 3:46472984-46473006 ATGTAGTGACTGAAAGAGAAAGG - Intronic
954573499 3:51661772-51661794 AGGGAGGGAGAGAAAGAAGAAGG - Intronic
954940551 3:54368440-54368462 AGGGAGAGAAAGAAAGAGAAGGG + Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956137137 3:66110572-66110594 ATGAAGAGAGAGAAAGAGAAAGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956418585 3:69060833-69060855 AGGGAGCAAGAGAGAGAGGAGGG - Intronic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957274111 3:78068206-78068228 ATACAGAGACAGAGAGAGGAGGG + Intergenic
957792777 3:84960566-84960588 AAGAAGCGGCAGAGAGAGGATGG - Intronic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961821830 3:129579143-129579165 ATGGAACGAAAGAAGGAGGGAGG + Intronic
961865930 3:129953499-129953521 AAGGAGGGAAAGAAAAAGGAAGG - Intergenic
961984186 3:131115147-131115169 ATGGAACAAAAGACAGAGGAAGG + Intronic
962010194 3:131384158-131384180 ATGGAGAGAGAAAAAGAAGAGGG + Intronic
962012029 3:131401165-131401187 AGGGAGCGACAGAGAGGGGAGGG + Intergenic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962388254 3:134950606-134950628 ATGGAGCAAGAGAGAGAGAAGGG + Intronic
962490885 3:135893073-135893095 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
962585654 3:136840513-136840535 AGGGAGGGAGAGAGAGAGGAAGG - Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
962866511 3:139451887-139451909 ATGGTGGGACAGAAGGATGAAGG + Intergenic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963871591 3:150421224-150421246 ATGGAGTGACTCAAAGAGGAAGG - Intronic
964494359 3:157272297-157272319 AGGGAGAGAGAGAGAGAGGAAGG - Intronic
965026858 3:163313525-163313547 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
965048137 3:163605947-163605969 ATGGAGAGAGAGAGAGAGGCTGG + Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965565422 3:170111379-170111401 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
965938525 3:174146168-174146190 ATAGAAGGAAAGAAAGAGGAAGG - Intronic
966458040 3:180140551-180140573 ATGGAAAGACAGAAAGAGTCTGG - Intergenic
966748147 3:183297663-183297685 ACAGAGAGAAAGAAAGAGGAAGG - Intronic
966763803 3:183440754-183440776 AGGGAGCAAGAAAAAGAGGAAGG + Intergenic
966941295 3:184749318-184749340 AGGGAGAGAAAGAAAGAAGAAGG + Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
967616068 3:191568310-191568332 ATGGAGCGTGAGAAAGAGGCAGG + Intergenic
967991081 3:195131236-195131258 ATGGGGAGACGGAAAGAGGGTGG - Intronic
968957401 4:3726299-3726321 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957407 4:3726323-3726345 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957413 4:3726347-3726369 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969246436 4:5936263-5936285 TTAGAAAGACAGAAAGAGGATGG + Intronic
969507056 4:7594602-7594624 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
972103174 4:35447592-35447614 AAGGAGGGAGAGAGAGAGGAAGG + Intergenic
972217912 4:36917459-36917481 ATGGAGCAAGAGGAAGGGGAGGG + Intergenic
972415769 4:38839065-38839087 ATAGAAAGAGAGAAAGAGGAAGG + Intronic
973061783 4:45735451-45735473 AGGGAGGGAAAGAGAGAGGAAGG - Intergenic
973320377 4:48804231-48804253 AGAGAGAGAGAGAAAGAGGATGG - Intergenic
973555828 4:52081939-52081961 ATGGATCGACAGAAACCTGAAGG - Intronic
973686302 4:53373460-53373482 ATGGAAGTACATAAAGAGGAAGG + Intergenic
973849305 4:54945539-54945561 AGGGAGGGAGAGAAAGAGAAGGG + Intergenic
975430270 4:74281716-74281738 AGGGAGGGAAAGAGAGAGGAAGG - Intronic
975462901 4:74675260-74675282 GTGGGGCTAGAGAAAGAGGATGG + Intergenic
975519560 4:75285647-75285669 ATTGAGAGAAAGAAAAAGGAAGG + Intergenic
975815460 4:78212283-78212305 ATGCAGCGAATGCAAGAGGAAGG - Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
977115751 4:93025143-93025165 AGAGAGGGAGAGAAAGAGGAAGG + Intronic
977241877 4:94581303-94581325 GTGGAGCGGCAGCAAGTGGAGGG - Intronic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
977919239 4:102625343-102625365 ATGGTGAGAGAGAAAGAGAAAGG - Intergenic
978178730 4:105767099-105767121 ATGGATGGACAGAAAAAAGAAGG + Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978286692 4:107086321-107086343 ATGGAAAGAGAGAGAGAGGAAGG + Intronic
978406250 4:108382192-108382214 ATGCAGCTACAGAAAGAGAATGG + Intergenic
979238034 4:118423720-118423742 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
979552867 4:122010621-122010643 ATGGAGGGATAGAAACTGGAGGG - Intergenic
980054041 4:128062409-128062431 AGGGAGCGGCAGGAAGAGGTGGG + Intronic
980115814 4:128678169-128678191 ATGGAGAGACAGGGAGATGAGGG - Intergenic
980568898 4:134584164-134584186 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
980579171 4:134727461-134727483 ATGGAGTCAAAGGAAGAGGAAGG + Intergenic
980901362 4:138908273-138908295 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
980928680 4:139164093-139164115 AGGGAGAGAGAGAAAGAGGGAGG + Intronic
981013581 4:139951127-139951149 ATGGGGAGAAAGAAAGAGGGAGG - Intronic
981259254 4:142700034-142700056 AGGGAGAGAGAGAAAGAGGGTGG - Intronic
981313558 4:143319649-143319671 ATAGAGCAAAGGAAAGAGGAAGG + Intergenic
981390003 4:144178333-144178355 ACAGAGAGACAGAAAGAGGCTGG - Intergenic
981783215 4:148448364-148448386 AGGGAGAGTCAGAAAGAGAAAGG + Intergenic
982081368 4:151793452-151793474 ATGGTGGGTCAGAGAGAGGAAGG + Intergenic
983855920 4:172644723-172644745 ATGGAGCGAAAGAAACAAAAAGG + Intronic
984506396 4:180624307-180624329 ATGGGGCGACATAAAGAGGCAGG - Intergenic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
985446529 4:190023825-190023847 AGGGAGGGAGAGAAGGAGGAGGG - Intergenic
985645167 5:1081531-1081553 AGGGAGAGAAAGAAAGAGAAGGG + Intronic
985661647 5:1160203-1160225 AGGGAGGGACAGAGAGAGGGAGG + Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986468384 5:8050036-8050058 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
986631607 5:9779197-9779219 ATGGAGCAAGGGAGAGAGGAAGG - Intergenic
986685266 5:10270841-10270863 ATGAAGGGCCAGAAACAGGAGGG - Intergenic
986879040 5:12147657-12147679 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
986879048 5:12147681-12147703 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
987266148 5:16257087-16257109 ATGGAGAGAGAGAGAGAGAAGGG + Intergenic
987325416 5:16807816-16807838 AAGGAGCGTCACAATGAGGAGGG - Intronic
987488605 5:18550359-18550381 AGAGAGCGAGAGAGAGAGGAAGG - Intergenic
987598668 5:20036421-20036443 AAGGAGTGAAAAAAAGAGGAGGG + Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
989411912 5:41129308-41129330 ATAGAGAGAGAGAAAGAAGAAGG - Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990000116 5:50882877-50882899 ATGGAGTGGCAAGAAGAGGAAGG - Intergenic
990130370 5:52574755-52574777 ATAGAGAGACAGAGAGAGAAAGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
991337640 5:65566750-65566772 AGGGAGGGAAAGAAAGACGAAGG - Intronic
991604975 5:68392182-68392204 ATGAAGAGAGAGAAAGGGGAGGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992290664 5:75276084-75276106 AAGGAGGGACAGAAAGAGTCGGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993477000 5:88378562-88378584 AGGAAGGGAAAGAAAGAGGAAGG + Intergenic
993552160 5:89286868-89286890 ATGGCTTGACAGACAGAGGATGG + Intergenic
994279451 5:97884366-97884388 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
995008358 5:107229214-107229236 ATGCAGGGACAGAGACAGGAGGG - Intergenic
995038513 5:107562337-107562359 ATGGAGAGAGAGACAGACGATGG - Intronic
995045552 5:107642723-107642745 ATGGAGAGAAAGAAAGAATACGG + Intronic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
996995822 5:129695709-129695731 ATGGGGTGACAGAAAGAGTGAGG + Intronic
998131359 5:139652994-139653016 ACGGAGATACAGAAAGAGAAAGG - Intronic
998372418 5:141670463-141670485 ATACAGGGACAGAAAGTGGATGG - Intronic
998859597 5:146429296-146429318 AGGGAGAGAAAGAAAGAGGTTGG - Intergenic
999487142 5:152008170-152008192 GGGGAGAGACAGACAGAGGAGGG - Intergenic
999694443 5:154176331-154176353 AGGGAGCAAGAGAGAGAGGAAGG - Intronic
1000147946 5:158471541-158471563 ATGCAGTGACAGAAAGTGAAGGG - Intergenic
1000335833 5:160240731-160240753 GGGGAGAGAGAGAAAGAGGAAGG + Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1001175741 5:169467453-169467475 GTGGAGGGAGAGAAAGATGAAGG + Intergenic
1001333924 5:170782671-170782693 ATGGAGGGGCAGGAAGGGGAGGG - Exonic
1001412751 5:171522433-171522455 ATGGAGGCACAGAGAGGGGAAGG - Intergenic
1001686351 5:173597580-173597602 ATGGAGGGAAAGAAGGAGGGAGG - Intergenic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1002154427 5:177265482-177265504 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1002214177 5:177618103-177618125 AAGGAGGGAAAGAAAAAGGAAGG - Intergenic
1002738465 5:181415691-181415713 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003604824 6:7549768-7549790 AGGGAGAGATGGAAAGAGGAAGG + Intronic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1003893839 6:10588119-10588141 AGAGAGGGACAGAAAGAGGATGG + Intronic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1004638809 6:17494337-17494359 ATGGAGCGACTGAGGGAGAAAGG - Intronic
1005140167 6:22622755-22622777 TTGGAGGGAAAGGAAGAGGAAGG + Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006357692 6:33570056-33570078 GTGGAGAGAGAGAAAGAGAAGGG - Intergenic
1006443671 6:34067353-34067375 AGGGAGCGAAGGAAGGAGGAAGG - Intronic
1006616151 6:35328493-35328515 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1006716342 6:36123113-36123135 AGGGAGGGAAGGAAAGAGGAAGG + Intergenic
1007492410 6:42233642-42233664 AAGGAGGGAGGGAAAGAGGAAGG - Intronic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008505347 6:52224682-52224704 AAAGAGAGACAGAAAGAAGAGGG - Intergenic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010075243 6:71790292-71790314 AGGGAGAGAGAGAAAGAGAAAGG + Intergenic
1010168159 6:72941495-72941517 AGGGAGGGAGAGAAAAAGGAAGG - Intronic
1010562349 6:77366184-77366206 AGGGAGCAAGAGAGAGAGGAAGG - Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1010848198 6:80738418-80738440 AGGGAGGGACAGAGAGAGGGAGG - Intergenic
1010922789 6:81704753-81704775 AGGGAGGGAGGGAAAGAGGAAGG + Intronic
1010966372 6:82213850-82213872 AGGGAGAGAGAGGAAGAGGAGGG + Intronic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1012097793 6:94986561-94986583 ATCGAGAGACAGAACGAGAAAGG + Intergenic
1012848029 6:104414091-104414113 ATGGAGCAACAGAAAGGAGGTGG + Intergenic
1013269662 6:108534225-108534247 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1013308305 6:108870510-108870532 AGAGAGAGACAGAAAGAGAAAGG + Intronic
1013633083 6:112003774-112003796 AAGGAGAGAGAGAAAGAGAAGGG + Intergenic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014005576 6:116414017-116414039 AGGCAGCGACAGGAAGATGATGG + Intronic
1014888768 6:126816148-126816170 ATGGAAGGAAAGAAAGAGGAAGG - Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015810908 6:137161385-137161407 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1016619883 6:146096362-146096384 ATGGAGCCTAAGTAAGAGGAAGG + Intronic
1017041052 6:150308986-150309008 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017572914 6:155766593-155766615 AGGGAGGGACAGAGAAAGGAAGG - Intergenic
1017792436 6:157813245-157813267 ATGTCGTGACAGAAACAGGACGG - Intronic
1018577109 6:165270546-165270568 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018931611 6:168243730-168243752 AGAGAGGGACAGAGAGAGGATGG - Intergenic
1019243568 6:170691244-170691266 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1019821000 7:3242661-3242683 AGAGAGAGACAGAGAGAGGAGGG - Intergenic
1019955358 7:4410179-4410201 AAGGAGCGGCAGCAAGAGAAAGG + Intergenic
1019968832 7:4523908-4523930 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021362096 7:19728183-19728205 AGAGAGAGAAAGAAAGAGGAGGG - Intronic
1021526800 7:21597165-21597187 AGGGAGCGAAAGGAAGAGAAAGG - Intronic
1022327009 7:29341571-29341593 AGGGAGGGACAGAAAGAGGGAGG + Intronic
1022998631 7:35784804-35784826 ATGGAGGGGCAGAAAGAGAGGGG - Intergenic
1023565705 7:41522006-41522028 AGGGAGGGAGAGAAGGAGGAAGG + Intergenic
1024015148 7:45307044-45307066 ATGGAGCAAGAGAGAGAGAAGGG - Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024974589 7:55101362-55101384 ATAGAGCGACAGAAAGAACACGG - Intronic
1026100424 7:67379538-67379560 ATGGAGCAACAGAGATAGAAGGG + Intergenic
1026110548 7:67455761-67455783 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1026126775 7:67586313-67586335 ATGGAGAGAGAGAAAGAGAGTGG + Intergenic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1026223187 7:68418176-68418198 AGGGAGAGAAAGAAAGAGAAAGG - Intergenic
1026501754 7:70948643-70948665 ATGGAGCAAGAGAGATAGGAGGG - Intergenic
1026529563 7:71185176-71185198 AGAGAGAGACAGAGAGAGGAAGG - Intronic
1026610405 7:71854206-71854228 ATGGAGAGAAAGAAACAGGCCGG + Intronic
1026638774 7:72106558-72106580 AGGGAGAGAGAAAAAGAGGAAGG + Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026696941 7:72603305-72603327 ATGGATGGACAGATAGATGATGG + Intronic
1026837580 7:73648645-73648667 AGAGAGAGAAAGAAAGAGGAGGG - Intergenic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026927452 7:74204211-74204233 AAGGAGGGAGGGAAAGAGGAAGG + Intronic
1027545203 7:79519115-79519137 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1027899433 7:84091323-84091345 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1028882316 7:95893613-95893635 ATGGAGTGCCAGCAAGATGATGG - Intronic
1029106480 7:98180942-98180964 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1029162024 7:98559359-98559381 AGGGAGGGAAAGAAAGAAGAAGG - Intergenic
1029178711 7:98683890-98683912 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1029253817 7:99255453-99255475 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1029375083 7:100172222-100172244 AGGGAGGGAGAGAAAGAGAAAGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029854000 7:103494926-103494948 ATGGAGTAAGATAAAGAGGAAGG + Intronic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031014906 7:116562925-116562947 AGGAAGAGAAAGAAAGAGGAAGG + Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1032841768 7:135719865-135719887 ATAGATAGATAGAAAGAGGAAGG + Intronic
1032890019 7:136183995-136184017 ATAGACTGAGAGAAAGAGGAAGG + Intergenic
1032996115 7:137448556-137448578 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033997397 7:147368054-147368076 AGGGAGAGAAAGAGAGAGGAAGG - Intronic
1034020824 7:147640767-147640789 ATACAGAGACAGAGAGAGGAAGG + Intronic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034985271 7:155509515-155509537 AGGGAGAGACAGAGAGAGGGAGG + Intronic
1035504554 8:116914-116936 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
1036010568 8:4717290-4717312 ATGGAGAGAGAGAGAGAGAAGGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036546097 8:9771349-9771371 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1036743799 8:11389997-11390019 ATGGAGAGAGAGAGAGATGAAGG + Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1038326806 8:26577972-26577994 AAGGAGAGAGAGAAACAGGAGGG - Exonic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039451156 8:37675889-37675911 ATGGAGAGAGAGAGAGAGGGAGG - Intergenic
1039673352 8:39629689-39629711 AAAGAGTGAAAGAAAGAGGAAGG - Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042327971 8:67548128-67548150 AGGGAGAGAGAGAGAGAGGAAGG - Intronic
1042492068 8:69410797-69410819 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1042513923 8:69640094-69640116 AGGGAGAGAGAGAGAGAGGAAGG + Intronic
1042636771 8:70885558-70885580 ATGGATCAACGGAAAGGGGAGGG - Intergenic
1042758206 8:72241746-72241768 AGAGAGGGAGAGAAAGAGGAAGG + Intergenic
1043022979 8:75027761-75027783 ATGGAAGGAAAGAAAGAGAAGGG - Intronic
1043055935 8:75438533-75438555 ATGAAGAGAGAGAAAGAGGGAGG - Intronic
1044223309 8:89695580-89695602 GTGAGGCGACAGAAAGAGGATGG + Intergenic
1044516365 8:93143320-93143342 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1045481690 8:102597868-102597890 ATGGAGTGCCAGCAAGAGCAGGG + Intergenic
1045487163 8:102640564-102640586 AGGGAGAGAAGGAAAGAGGAAGG + Intergenic
1045546151 8:103130524-103130546 ATAGAGAGAGAGAAAGAGGATGG - Intergenic
1045652544 8:104354426-104354448 ATGGGGCGAAAGAAAGAGCGGGG - Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046588478 8:116176558-116176580 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047069286 8:121324857-121324879 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1049249659 8:141581559-141581581 AGAGAGAGACAGAAAGAGGCGGG + Intergenic
1049478875 8:142810591-142810613 GTGGAGGGAAAGAAAGAGGGAGG - Intergenic
1050008868 9:1164299-1164321 ATGGAGGGAGGGAAGGAGGAAGG - Intergenic
1050357777 9:4799101-4799123 AGGGAGGGAGAAAAAGAGGAAGG - Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050647432 9:7735875-7735897 ATGGATTGAAAGAAAAAGGATGG - Intergenic
1051216409 9:14802978-14803000 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1051522065 9:18000447-18000469 ATGGACCCACAGTCAGAGGAAGG + Intergenic
1051607169 9:18927393-18927415 ATGGAGGGAAAGAAAGAGGGAGG - Intergenic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053553347 9:39107367-39107389 AGGGAGGGAGAGAAAGAGGGAGG + Intronic
1053580526 9:39399388-39399410 AGGGAGGGAAGGAAAGAGGAAGG - Intergenic
1053845022 9:42227466-42227488 AGGGAGGGAAGGAAAGAGGAAGG - Intergenic
1054102113 9:60958193-60958215 AGGGAGGGAAGGAAAGAGGAAGG - Intergenic
1054107710 9:61071195-61071217 AGGGAGGGAGAGAAAGAGGGAGG + Intergenic
1054584246 9:66948670-66948692 AGGGAGGGAAGGAAAGAGGAAGG + Intergenic
1054613147 9:67259930-67259952 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
1054757759 9:68976499-68976521 AAGGAGCTACAGCAAGAGGCAGG - Intronic
1054935828 9:70686742-70686764 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
1055033892 9:71797439-71797461 ATGAAGAGATGGAAAGAGGAAGG - Intronic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055914524 9:81387313-81387335 AGGGATGGACAGAGAGAGGAAGG + Intergenic
1056069745 9:82973789-82973811 ATGAAGAGAAAGAAAGAGAAAGG - Intergenic
1056292528 9:85158085-85158107 AGGGAGGGAGGGAAAGAGGAGGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056422501 9:86442979-86443001 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1056523173 9:87418826-87418848 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057115977 9:92522536-92522558 AGAGAGAGACAGAAAGAGGGAGG - Intronic
1058433397 9:104939537-104939559 AGCGAGAGAGAGAAAGAGGAGGG - Intergenic
1059352891 9:113678107-113678129 AGGGAGGGAAAGAAAGAAGAAGG - Intergenic
1059897743 9:118886890-118886912 ATGGAGCGAGAGAATAAGTAAGG - Intergenic
1060165718 9:121412853-121412875 ATAGAGGGAGAGACAGAGGAGGG - Intergenic
1060481466 9:124018795-124018817 ATGGAGGGAGAGAAAGAGAGAGG - Intronic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061724970 9:132577292-132577314 ATGGAGGGAGAAAAAAAGGAAGG + Intergenic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1203603757 Un_KI270748v1:40467-40489 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1185604667 X:1361176-1361198 ATGGAGAGAGAGAGAGGGGAAGG - Intronic
1185662062 X:1735677-1735699 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185662065 X:1735692-1735714 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1186145783 X:6622114-6622136 ATGGAGGGACAGAAGGAAGGAGG + Intergenic
1186246614 X:7622471-7622493 ATGGAGGGAGAGGAAGAGGAAGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186317536 X:8386973-8386995 GTGGAGGGATAGAGAGAGGAAGG + Intergenic
1186544149 X:10431636-10431658 AGGCAGAGAGAGAAAGAGGAGGG - Intergenic
1187696156 X:21923157-21923179 AAGGAGAGAAAGAAAGAGAAAGG + Intergenic
1187829380 X:23365494-23365516 GGGGAGAGAAAGAAAGAGGAAGG + Intronic
1187957525 X:24534463-24534485 ATGCAGAGACACAAAGTGGAAGG + Intronic
1187959893 X:24558589-24558611 AGGGAGGGACAGGAAGAGCACGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188368415 X:29338714-29338736 ATGGAGAGACAGACAGAGACAGG - Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1189175616 X:38954389-38954411 ATGGAACGGTAGAGAGAGGAGGG - Intergenic
1190359820 X:49638260-49638282 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1190751833 X:53368865-53368887 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1190953137 X:55165519-55165541 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1193426777 X:81349126-81349148 ATGGGGTTACAGGAAGAGGAGGG - Intergenic
1194304476 X:92226086-92226108 ATGTAGGGACAGAAAGGGGAGGG + Intronic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1195385644 X:104311531-104311553 AGAGAGAGACAGAAAGACGAAGG - Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196757078 X:119167450-119167472 GTGTAGCTACAGCAAGAGGATGG + Intergenic
1197048494 X:122029365-122029387 ATGGAGAGAGAGCAACAGGAAGG + Intergenic
1197091094 X:122538657-122538679 AAGAAACGGCAGAAAGAGGATGG + Intergenic
1197117221 X:122848018-122848040 ATGGTGCAACAGAAAGAGCACGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198607935 X:138364375-138364397 ATTGAGTGACAGAAAGACAAAGG - Intergenic
1198672891 X:139100348-139100370 ATGGTGGGAGAGAGAGAGGAGGG + Intronic
1199659553 X:150035205-150035227 ATGTCGCCACAGTAAGAGGAAGG - Intergenic
1200978209 Y:9236335-9236357 ATGGAGGGAGAGAAGGAAGAGGG - Intergenic
1201253838 Y:12088001-12088023 ACGGTGAGAGAGAAAGAGGAAGG - Intergenic
1201451168 Y:14116258-14116280 ATGGAGGGAGGGAGAGAGGAAGG + Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1202385817 Y:24325519-24325541 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1202484969 Y:25344609-25344631 GTGGAGGGACAGAAAGAAGTGGG + Intergenic