ID: 1136508691

View in Genome Browser
Species Human (GRCh38)
Location 16:30722730-30722752
Sequence TCACCCTGGTTAGCAGCAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136508691_1136508697 9 Left 1136508691 16:30722730-30722752 CCGCTTGCTGCTAACCAGGGTGA 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1136508697 16:30722762-30722784 CCTTCCTACTTAGCCCTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1136508691_1136508699 15 Left 1136508691 16:30722730-30722752 CCGCTTGCTGCTAACCAGGGTGA 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1136508699 16:30722768-30722790 TACTTAGCCCTTGCTGGCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 119
1136508691_1136508702 25 Left 1136508691 16:30722730-30722752 CCGCTTGCTGCTAACCAGGGTGA 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1136508702 16:30722778-30722800 TTGCTGGCCTTGGTCCTTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136508691 Original CRISPR TCACCCTGGTTAGCAGCAAG CGG (reversed) Exonic
902107855 1:14052682-14052704 TCATCCTGGAGAGCAGCAAAAGG + Intergenic
903134767 1:21302286-21302308 CCACCCTGGTGCACAGCAAGGGG - Intronic
903304166 1:22401045-22401067 TCACCCACTTTGGCAGCAAGAGG + Intergenic
904570963 1:31464568-31464590 TCTCGGTGGTTAGCAGCACGAGG - Intergenic
908120128 1:60978533-60978555 TCCAGCTGATTAGCAGCAAGAGG - Intronic
908768049 1:67571789-67571811 TCACCCTGTTAAGTAGCTAGTGG - Intergenic
909344271 1:74567253-74567275 ACACCATGGGCAGCAGCAAGAGG - Intergenic
913076045 1:115341248-115341270 TCACTCTGATTAGAAGGAAGAGG - Intergenic
915916399 1:159943404-159943426 TCAGCCTGGTCATCAGCCAGGGG - Exonic
916488015 1:165276532-165276554 TCACCCTGGTTTGGAGCATATGG - Intronic
916503111 1:165403909-165403931 ACCCACAGGTTAGCAGCAAGGGG + Intronic
920828606 1:209445721-209445743 TTACTCTGGTCAGCAGGAAGAGG - Intergenic
922631568 1:227119182-227119204 TCACGGTGCTTAGCAGCATGTGG + Intronic
922700631 1:227757975-227757997 TCACCCTGCTGGGCAGCATGGGG + Intronic
923263131 1:232286226-232286248 ACATCCTGGGTAACAGCAAGAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063422939 10:5928031-5928053 TCACCCAGGTTAGAAGGCAGTGG - Intronic
1063470491 10:6280709-6280731 CGTCCCTGGTTAGAAGCAAGGGG + Intergenic
1066566736 10:36729184-36729206 ACACCCTGATTAGCAGGAGGAGG - Intergenic
1067306438 10:45069074-45069096 TCTCCGTGGTTAGCAGCACAAGG - Intergenic
1070987221 10:80699573-80699595 TAACCCTGGCCAGCAGGAAGGGG - Intergenic
1074189042 10:111119973-111119995 TCAGACTGGTTAGGAGGAAGAGG + Intergenic
1076512617 10:131023199-131023221 ACACTTTGATTAGCAGCAAGGGG + Intergenic
1079520496 11:21320781-21320803 TCATCCTGGACAGCAGCAAGTGG - Intronic
1079597058 11:22262928-22262950 TCACACTAGTCAGAAGCAAGAGG - Exonic
1080947980 11:36996432-36996454 CCACCATGTTTAGCAGCAAGTGG + Intergenic
1085695635 11:78702229-78702251 CCACCTTGCTTAGCAGGAAGTGG + Exonic
1089125067 11:116171020-116171042 GCACCCTCGTTAGCACCAGGAGG + Intergenic
1090513705 11:127401981-127402003 CCAGCCTGGATAGCAGCATGAGG + Intergenic
1093356695 12:18175900-18175922 TCTCCGTGGTTAGCAGCACAAGG - Intronic
1094430839 12:30367644-30367666 TTTCCCTGGTGACCAGCAAGGGG + Intergenic
1095656172 12:44671977-44671999 ACACCCTGGTTATCAGAGAGAGG + Intronic
1097601577 12:61699371-61699393 TGCCCCTTGTCAGCAGCAAGTGG + Intergenic
1101117499 12:101546659-101546681 TCACCCAGGCTAGCAGGTAGTGG + Intergenic
1104288518 12:127447255-127447277 TGACCCTGATTGGCAGAAAGAGG + Intergenic
1104308540 12:127633168-127633190 TCCCGCTGGTTTCCAGCAAGGGG - Intergenic
1106137337 13:26983530-26983552 TGACCCTCATTAGCAGCAGGAGG - Intergenic
1109470615 13:62799408-62799430 GCACCCTGAATAGCAGCAGGAGG + Intergenic
1110302028 13:73939906-73939928 TGATCCTGGTGAGGAGCAAGGGG - Intronic
1116201488 14:41803389-41803411 TCACCCAGGTTAGAAGGCAGTGG + Intronic
1118574725 14:67230960-67230982 ACAGCCTGGATAGCTGCAAGGGG - Intergenic
1120552953 14:85893547-85893569 TCCCCCAGGATAGCAGTAAGAGG - Intergenic
1121155027 14:91675141-91675163 TCAACCTGGTTTGCAACGAGTGG + Intronic
1122407714 14:101510053-101510075 ACACCCTGGCGAGCAGCATGGGG + Intergenic
1123389285 15:19853359-19853381 ACACCCTGATTAGCAGGAGGAGG - Intergenic
1124899357 15:33807905-33807927 TGACCCTGGGTAGCACCACGAGG - Intronic
1127601592 15:60543047-60543069 TCACGCAGGTTCTCAGCAAGTGG - Intronic
1128393953 15:67204288-67204310 TCACCCTGCTTGGCTGCTAGTGG + Intronic
1132097212 15:98996381-98996403 TCAGCATTGTGAGCAGCAAGGGG - Intronic
1132836916 16:1958805-1958827 CCCCCCTGGATAGCAGCCAGGGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135207127 16:20492951-20492973 GCACCTTGGCTAGCACCAAGGGG - Intergenic
1135211758 16:20530681-20530703 GCACCTTGGCTAGCACCAAGGGG + Intergenic
1136287282 16:29251969-29251991 GCAGCCTGGCAAGCAGCAAGAGG + Intergenic
1136508691 16:30722730-30722752 TCACCCTGGTTAGCAGCAAGCGG - Exonic
1136587433 16:31196368-31196390 CCACCCATGTTAGCGGCAAGAGG + Intergenic
1138471682 16:57243298-57243320 TTACTCTGTTTAGCACCAAGTGG - Intergenic
1138867834 16:60845396-60845418 TCACCCGGGTAAACAGCAAGGGG - Intergenic
1142434918 16:90050174-90050196 TGACCCTGGTTTTCAGAAAGGGG - Intergenic
1146540246 17:33687394-33687416 TCACCCTGGGTAGCAGCCCATGG - Intronic
1152133421 17:78490821-78490843 TCACCCTGGCCAGCAACGAGCGG - Exonic
1154532595 18:15362753-15362775 ACACCCTGATTAGCAGGAGGAGG + Intergenic
1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG + Intronic
1161326667 19:3667561-3667583 TCACCCTGGTTGGCAGCCACTGG + Intronic
1162228839 19:9248117-9248139 TCACCCAGGATAGCAAAAAGTGG + Intergenic
1164520076 19:28972339-28972361 TCACCCTGGCAAGCACCCAGGGG + Intergenic
925262069 2:2537605-2537627 TCAGCCTGACCAGCAGCAAGTGG - Intergenic
927206153 2:20611807-20611829 TCACCCTGCTCAGCAGCGTGGGG + Intronic
938531699 2:132193974-132193996 ACACCCTGATTAGCAGGAGGAGG + Intronic
938832964 2:135071793-135071815 TACCCATGGTTAGCAGGAAGTGG - Intronic
939888774 2:147710767-147710789 ACACCCTGGTTATCAGCACTCGG + Intergenic
942715413 2:178886140-178886162 TCTCCCAGGTCAGCAGGAAGAGG - Intronic
943740554 2:191402731-191402753 TCACCCTGGACAGAAACAAGTGG - Intronic
944522664 2:200587445-200587467 TCACACTGGTTAGCTTCCAGGGG - Intronic
947953973 2:234171695-234171717 GGCCCCTGGTTAGCAGCCAGGGG + Intergenic
1169093960 20:2879454-2879476 TGACCATGGTGAGCAGGAAGGGG + Intronic
1172332207 20:34082995-34083017 TCAACCTGGCTGGCAGCAACAGG - Intronic
1172487029 20:35304485-35304507 CCACCCTGGGTAGCAGCACTGGG - Intronic
1176764763 21:13005456-13005478 ACACCCTGATTAGCAGGAGGAGG - Intergenic
1177928258 21:27246986-27247008 TCACCATGGATTGCAGCTAGTGG - Intergenic
1179026508 21:37683295-37683317 TGGCCCTGGTTACCAGCAAGAGG + Intronic
1180511948 22:16100249-16100271 ACACCCTGATTAGCAGGAGGAGG - Intergenic
1184989020 22:48154887-48154909 TCAGCCTGGGTAGGAGCAGGAGG + Intergenic
950123076 3:10494762-10494784 TCACCCCAGGTAGCAGCATGTGG - Intronic
954465631 3:50652944-50652966 TCACCCAGGTGACCAGCAGGTGG - Intergenic
955083225 3:55677062-55677084 TCACCCTTGAGAGCAGAAAGAGG + Intronic
961476449 3:127149820-127149842 TCACCCTTGTGATCAGCACGGGG - Intergenic
961561490 3:127733495-127733517 TCACTCTTGTTACCAGAAAGGGG - Intronic
963042080 3:141077405-141077427 TCTCACTGGTGAGCAGCAGGGGG + Intronic
964662803 3:159139566-159139588 TGACCCTGTTCAGCAGCCAGAGG + Intronic
965921756 3:173925554-173925576 GCTCCCAGGTTAGCAGAAAGTGG - Intronic
969545480 4:7823848-7823870 TCAACCTGGTGCCCAGCAAGGGG + Intronic
971329764 4:25672916-25672938 TCAGCCTCCTTCGCAGCAAGGGG - Intronic
977338000 4:95721992-95722014 CCACCCTGGTTAGCTGAAAGGGG + Intergenic
979502966 4:121461063-121461085 TTGTCCTGGTTAGCAGTAAGGGG + Intergenic
981536296 4:145803398-145803420 TCAAGCTGGTTACCACCAAGAGG + Intronic
985744572 5:1638809-1638831 TCTCCCTGCTCAGCAGCGAGGGG - Intergenic
985766605 5:1783204-1783226 TCACCCTTCCTAGCAGCCAGAGG - Intergenic
988674743 5:33420360-33420382 TCACCCAAGTTATCATCAAGTGG + Intergenic
995970921 5:117970051-117970073 TCACCCTGGTCTGTAGCATGGGG - Intergenic
1001852504 5:174981707-174981729 CCACCCTCTTTAGCAGCAGGAGG - Intergenic
1003708247 6:8559578-8559600 TCACCCTAGTCAGCTGCAGGAGG - Intergenic
1006312188 6:33268645-33268667 TTGCCCTGGTTAGCAGGGAGGGG + Exonic
1007253353 6:40511502-40511524 ACAAACTGGTAAGCAGCAAGGGG + Intronic
1011574012 6:88774269-88774291 TCACCCTAGTTAGTATGAAGTGG - Intronic
1018572054 6:165222206-165222228 TCACCTTGAGAAGCAGCAAGGGG + Intergenic
1019505530 7:1388647-1388669 TCAACATGGTGAGCAGCCAGCGG - Intergenic
1022743775 7:33148933-33148955 TCATGCTCTTTAGCAGCAAGTGG + Intronic
1023867830 7:44247224-44247246 TGGCCCTGGGGAGCAGCAAGAGG + Intronic
1028333928 7:89628348-89628370 TCTCAGTGGTTAGCAGCAAAAGG - Intergenic
1028830936 7:95325831-95325853 CCACCCTGGTTAACACCAGGTGG + Intergenic
1029917497 7:104226841-104226863 TTAACCTGGTTCCCAGCAAGTGG + Intergenic
1032127462 7:129205405-129205427 TCACCCTGGTCAGCCGCGGGAGG + Exonic
1034236195 7:149571541-149571563 TCTCAGTGGTTAGCAGCATGAGG - Intergenic
1034694223 7:153039714-153039736 TGGCCCTGCTTAGCTGCAAGGGG + Intergenic
1036740886 8:11360767-11360789 TCCCCATGGTGAGCAGCAAAAGG - Intergenic
1040384366 8:46903867-46903889 TCACCCAGGTTCTCACCAAGAGG + Intergenic
1043379496 8:79687480-79687502 ACACCCTGGTTGGCATCAATAGG + Intergenic
1052071328 9:24085001-24085023 TCACCCTGTCTATCAGCAAAGGG - Intergenic
1053710307 9:40800470-40800492 ACACCCTGATTAGCAGGAGGAGG + Intergenic
1054420214 9:64921265-64921287 ACACCCTGATTAGCAGGAGGAGG + Intergenic
1056137917 9:83647471-83647493 TGACTCTGGTGAGCAGCCAGGGG + Intergenic
1056199216 9:84258319-84258341 CCACCCTGGTGTGTAGCAAGGGG + Intergenic
1185872324 X:3674332-3674354 TCACCCAGGAGAGGAGCAAGGGG + Intronic
1190480336 X:50870710-50870732 TCACCATTGTTAGGAGCATGTGG + Intergenic
1195071350 X:101283523-101283545 TCAACCAGCTTAGCAGCTAGTGG + Exonic
1197695649 X:129547187-129547209 TCACCCAGGTTAGCATGCAGTGG - Intronic
1200791582 Y:7304349-7304371 TCACCCAGGAGAGGAGCAAGGGG - Intergenic
1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG + Intergenic