ID: 1136508766

View in Genome Browser
Species Human (GRCh38)
Location 16:30723123-30723145
Sequence CCGGCTACCCACACCTACTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136508761_1136508766 -7 Left 1136508761 16:30723107-30723129 CCACGTTAACCCCTGGCCGGCTA 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1136508756_1136508766 0 Left 1136508756 16:30723100-30723122 CCACGCCCCACGTTAACCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1136508760_1136508766 -6 Left 1136508760 16:30723106-30723128 CCCACGTTAACCCCTGGCCGGCT 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1136508755_1136508766 15 Left 1136508755 16:30723085-30723107 CCAGCTGTGTTGAATCCACGCCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1136508759_1136508766 -5 Left 1136508759 16:30723105-30723127 CCCCACGTTAACCCCTGGCCGGC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1136508754_1136508766 30 Left 1136508754 16:30723070-30723092 CCGAGCTCTGGGCTTCCAGCTGT 0: 1
1: 0
2: 6
3: 39
4: 455
Right 1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG 0: 1
1: 0
2: 1
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136508766 Original CRISPR CCGGCTACCCACACCTACTC TGG Exonic
900566679 1:3335787-3335809 CCAGCTGCCCACACCTCCCCTGG + Intronic
901790492 1:11651200-11651222 CCTGCTCCCCTCACCTCCTCAGG + Intronic
904781920 1:32956250-32956272 CCAGCTACTCCCAGCTACTCGGG + Intronic
906650102 1:47506891-47506913 CCCACTCCCCACACCTTCTCTGG - Intergenic
907179083 1:52553621-52553643 CCCGCCACCCCCACCCACTCCGG - Intergenic
907520169 1:55018613-55018635 CCGGCTTCCCACAGCTGCCCCGG - Intergenic
909391309 1:75125234-75125256 GCGGCCACCCACACCGACTTTGG + Intergenic
912423848 1:109568419-109568441 CCAGCTACTCCCAGCTACTCAGG + Intronic
918589299 1:186222486-186222508 GTGGATACCAACACCTACTCTGG - Intergenic
922318186 1:224460892-224460914 CCGGCTACTCACAGCTACTCAGG - Intronic
922709522 1:227816268-227816290 CCAGCTACCCACACCATCCCAGG - Intronic
924164251 1:241265475-241265497 CTGGCTACCTACACCTCCTGTGG - Intronic
1065070771 10:22021819-22021841 CCAGCTACTCCCAGCTACTCTGG - Intergenic
1073500345 10:103931511-103931533 CCTGCTTCCCTCACCCACTCAGG - Intergenic
1075873204 10:125786110-125786132 CCGGCTTCCCACATTGACTCTGG + Intronic
1076204206 10:128582130-128582152 CCGGCTTCCCCTACCTTCTCAGG - Intergenic
1077442420 11:2574889-2574911 CCTGCTGCCCAAACCTGCTCAGG - Intronic
1079320583 11:19448240-19448262 CTGCCTGCCCACACCTCCTCAGG - Intronic
1080534999 11:33212834-33212856 CCAGCTACTCACAGCTACTCAGG + Intergenic
1081605685 11:44525910-44525932 CCGGTGTCCCACACCTAGTCTGG - Intergenic
1083079642 11:60077310-60077332 CCGTCTACTTCCACCTACTCCGG + Intergenic
1084795719 11:71503155-71503177 CCGGCACCCCACACCTTCTCAGG + Intronic
1089740165 11:120576907-120576929 CCAGCTCCCCACCCCGACTCAGG - Intronic
1097062661 12:56297577-56297599 CCTGCTAACCCCAGCTACTCAGG + Intronic
1097248937 12:57621806-57621828 CCGGCTACCCACGCCGATCCCGG + Exonic
1102322449 12:111948969-111948991 CCAGCTACTCAGAGCTACTCAGG + Intronic
1104602501 12:130162842-130162864 CCGGCTCTCCACCCCTGCTCGGG - Exonic
1105898203 13:24735681-24735703 CCAGCTACTCATAGCTACTCAGG + Intergenic
1105948148 13:25207180-25207202 CCTGCTATCCACACCAGCTCTGG - Intergenic
1106413335 13:29525944-29525966 CCGGCCACCCACTCCCACCCTGG + Intronic
1107264898 13:38541968-38541990 CCAGCTACTCCCAGCTACTCGGG - Intergenic
1109597021 13:64569936-64569958 ATGGATACCAACACCTACTCTGG + Intergenic
1111430429 13:88142879-88142901 CAGGCTGCCAAAACCTACTCAGG - Intergenic
1111725515 13:92003194-92003216 CCAGCTACTCCCAGCTACTCAGG + Intronic
1112235710 13:97634473-97634495 CCAGCTTCCCACACCCACTGTGG - Intergenic
1112900255 13:104349894-104349916 CCTGCTACCCACACTGACTCAGG + Intergenic
1116060496 14:39918584-39918606 CCGGATAATCACAGCTACTCAGG - Intergenic
1117535584 14:56699582-56699604 CCTGCTACCACCACCTTCTCGGG - Intronic
1117835681 14:59803463-59803485 CAGGCCACCCAAATCTACTCTGG + Intronic
1202893746 14_KI270722v1_random:183615-183637 CCGGCTTCACCCACCCACTCCGG - Intergenic
1125743834 15:41985899-41985921 CCAGCTACCCGCCCCTCCTCAGG - Exonic
1127122566 15:55784569-55784591 CCACCTACCCACCCCTGCTCTGG + Intergenic
1130335542 15:82953949-82953971 CCAGCTACTCCCAGCTACTCGGG + Intronic
1132674715 16:1116934-1116956 CCGCCTACCCTCCCCAACTCAGG + Intergenic
1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG + Exonic
1143843352 17:9752614-9752636 CCAGCTACACACACCTGTTCAGG - Intergenic
1152604793 17:81283736-81283758 TCGGCTACTCCCAGCTACTCGGG - Intronic
1152633135 17:81419611-81419633 CCCCCGACCCACACCCACTCAGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1165389549 19:35530441-35530463 CCGGCTAATCCCAGCTACTCGGG - Intergenic
928135119 2:28682264-28682286 CCTGCGCCCCCCACCTACTCTGG + Intergenic
929791407 2:45025602-45025624 CCAGCTCCCCCCACCTTCTCCGG - Intergenic
933505386 2:83170734-83170756 CCAGCTACTCAGAGCTACTCAGG - Intergenic
937060134 2:118974744-118974766 GCGGCTGCCCAGCCCTACTCTGG - Intronic
937325709 2:120988700-120988722 CCGGCTGCCCACGCCCACTGGGG + Exonic
937443721 2:121938462-121938484 CCAGCTAACCCCAGCTACTCAGG + Intergenic
938013875 2:127851089-127851111 CGGGCTACTCCCAGCTACTCGGG + Intronic
943232535 2:185273228-185273250 TCTGCTACCCACAGTTACTCAGG - Intergenic
944833694 2:203557634-203557656 CTCTCTACCCACACCTACACAGG - Intergenic
1169557656 20:6767823-6767845 CCGGCTACCCGAACGTTCTCGGG + Exonic
1171280624 20:23893563-23893585 ATGGATACCAACACCTACTCTGG + Intergenic
1171372079 20:24668619-24668641 CCGGGTACCCCCACCTCCCCAGG + Intergenic
1173261574 20:41441017-41441039 TCAGCTACCCACAGCTCCTCAGG - Intronic
1179206534 21:39285813-39285835 CCAGCTACTCCCAGCTACTCAGG + Intronic
1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG + Intergenic
1182910007 22:33975339-33975361 CCGGTTCCCCAGACCTACTGGGG - Intergenic
1183369434 22:37424150-37424172 GCTGCTACCCTCACCTGCTCCGG - Intronic
1184856743 22:47150495-47150517 CCGGCCACCCAGACCGCCTCAGG - Intronic
949799224 3:7884673-7884695 TTGGATACCAACACCTACTCTGG - Intergenic
953886806 3:46718661-46718683 CCAGCTACTCTCAGCTACTCAGG + Intronic
954542839 3:51406724-51406746 CATGCTACCCACTCCTGCTCTGG + Intronic
955397191 3:58565933-58565955 CCTTCTAACCACACCTACCCAGG - Exonic
961629379 3:128285022-128285044 CCAGCTTTCCACACCCACTCTGG - Intronic
962853300 3:139323853-139323875 CCTGCTTCCCACCCCTCCTCAGG + Intronic
968408794 4:366797-366819 CCAGCTACTCCCAGCTACTCAGG - Intronic
982553042 4:156826315-156826337 CCAGCTACTCACAGCTACTCAGG - Intronic
985797877 5:1977073-1977095 CTGGCTACCCACTCCTCCCCTGG + Intergenic
985943857 5:3161909-3161931 CCGGCTACGCACATCTTCTTAGG + Intergenic
992522463 5:77568820-77568842 CTGGCTTCCCACACCTAATCTGG + Intronic
994358045 5:98817036-98817058 GTGGCTACCAGCACCTACTCTGG - Intergenic
995234876 5:109817039-109817061 CCTGCTACTCCCAGCTACTCAGG + Intronic
997642087 5:135455978-135456000 CCGGCACCACACCCCTACTCAGG + Intergenic
1002005804 5:176233683-176233705 CCAGCTACTCCCAGCTACTCGGG + Intergenic
1002220572 5:177676943-177676965 CCAGCTACTCCCAGCTACTCGGG - Intergenic
1005562389 6:27054055-27054077 CTGCCTACCCACAGCTGCTCTGG - Intergenic
1007792175 6:44316620-44316642 CCAGCTACACCCACCTACTCTGG - Intronic
1019197388 6:170290440-170290462 CCGGCGACCCTCACCTCCTCGGG - Exonic
1019611785 7:1940442-1940464 CCAGCCACCCACACGCACTCAGG + Intronic
1020139577 7:5605214-5605236 CTGGCTCCCCACCCCTACCCTGG - Intronic
1031986264 7:128166588-128166610 CCTGCTTCCCGCATCTACTCAGG + Intergenic
1033310763 7:140260183-140260205 CCCGCTGCCCACACCAACACTGG + Intergenic
1034063159 7:148111230-148111252 CCTGCCACCCACCCCTACCCTGG - Intronic
1035519618 8:266275-266297 CTGGCTGCCCCCACCTCCTCAGG - Intergenic
1039864777 8:41490975-41490997 CTGGCTCCCCACGCCTGCTCTGG + Intronic
1049367402 8:142247113-142247135 CCTGCTTCCCACACCTGCCCAGG - Intronic
1056047281 9:82732403-82732425 TCAGCTCCCCACACCTACACTGG - Intergenic
1056505470 9:87254133-87254155 CCACCTGGCCACACCTACTCAGG - Intergenic
1059311506 9:113391623-113391645 CCCTCTACCCACACCCACACAGG - Exonic
1060974648 9:127757553-127757575 CCAGCTACTCAGAGCTACTCAGG - Intronic
1061108418 9:128550336-128550358 CCAGCTTTCCACACCTACTAGGG + Intergenic
1062496720 9:136835369-136835391 CCCGCCACGCACACCTCCTCTGG - Intronic
1187348928 X:18494037-18494059 CCAGCTACTCCCAGCTACTCAGG - Intronic
1194424059 X:93715347-93715369 CCTGCTACCCAAACCTTCACAGG + Intergenic
1194838848 X:98714556-98714578 CAGGCTGCCCACGGCTACTCTGG + Intergenic