ID: 1136510141

View in Genome Browser
Species Human (GRCh38)
Location 16:30732803-30732825
Sequence CCTTAAAGGAAGAACTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136510134_1136510141 22 Left 1136510134 16:30732758-30732780 CCAAGAAGTTAGATTCTAGGCTG 0: 1
1: 0
2: 2
3: 39
4: 589
Right 1136510141 16:30732803-30732825 CCTTAAAGGAAGAACTTGTATGG 0: 1
1: 0
2: 1
3: 11
4: 148
1136510137_1136510141 -8 Left 1136510137 16:30732788-30732810 CCGAAGAGGTGAAGCCCTTAAAG 0: 1
1: 0
2: 2
3: 20
4: 179
Right 1136510141 16:30732803-30732825 CCTTAAAGGAAGAACTTGTATGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136510141 Original CRISPR CCTTAAAGGAAGAACTTGTA TGG Intronic
901412603 1:9094943-9094965 CATTAAAGGAATGACTTGGATGG - Intergenic
902091062 1:13903659-13903681 ACTTAAAGAAAGAACTGGTCTGG + Intergenic
904101013 1:28027238-28027260 TGTTAGAGGAAGAACTTGGAAGG + Intronic
904197060 1:28793840-28793862 CCTTAAAGGAAGAGATAGTATGG + Intergenic
908159421 1:61392064-61392086 CCTTAAAGGTGGTACTTGTTAGG - Intronic
909465272 1:75966955-75966977 TCTTAAAGGAACAACATGGAAGG - Intergenic
909492321 1:76239142-76239164 CCTTGAAGGAAGAATCTGAAGGG + Intronic
910316035 1:85884852-85884874 CTTTAAAGTAAGAACCTGTTAGG + Intronic
910320561 1:85938690-85938712 CCTTCAAGGAAGAACTTGTGTGG + Intronic
914807694 1:151003521-151003543 GCTTACTGGAAGAACTTGTGGGG - Intronic
914910238 1:151779729-151779751 CCTTAAAGAATCAATTTGTAAGG + Intronic
915643243 1:157246232-157246254 ACTGGAAAGAAGAACTTGTAGGG - Intergenic
915752236 1:158222504-158222526 CCTCATAGGAGGAACTTGTTGGG + Intergenic
920297016 1:204964449-204964471 CCATAGAGGGAGAAATTGTAGGG + Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921491122 1:215777251-215777273 AATGAAAGGAAGAACTGGTAGGG + Intronic
924535565 1:244932695-244932717 CTTTAAAGGAAGTTCTTGTCTGG - Intergenic
1063765185 10:9131413-9131435 CCTTAAATTAAAAACTTGTTTGG - Intergenic
1064158839 10:12925963-12925985 CCACAAAGGCAGAATTTGTAGGG + Intronic
1064711851 10:18135911-18135933 CCTTAAAGAAAGAGCTTTTTAGG - Intergenic
1065072905 10:22045895-22045917 CATTAAAGGAAAAATTTATATGG + Intergenic
1067678912 10:48413927-48413949 CGTTAAATGAATAAATTGTATGG - Intronic
1068287244 10:54954999-54955021 CCTGAAACCAAGAATTTGTATGG - Intronic
1070917339 10:80163405-80163427 CCTGAAAGGAAGCAGGTGTATGG + Exonic
1071526131 10:86360018-86360040 CCTAAAAGGCAGTGCTTGTAAGG + Intronic
1072010050 10:91294808-91294830 CCTTTCAGGAAGGACTTGGAGGG + Intergenic
1075388279 10:122073514-122073536 CATTAAAAGAAGAATTGGTAAGG - Intronic
1077233680 11:1469810-1469832 CCTCAAAGGAGGAACTCGTGGGG - Intronic
1078194676 11:9125680-9125702 CCTTAAAGAAGGAAGTTGAAGGG - Intronic
1078775870 11:14393160-14393182 CCCCAAAGGAAGCATTTGTAGGG - Intergenic
1081048325 11:38305166-38305188 GGTTAAAGAAAGAACTTGGACGG - Intergenic
1084466931 11:69328798-69328820 CATTAAAGGAATAACTTGGATGG - Intronic
1088299208 11:108338039-108338061 TCTTAATGGAATAACTTATATGG - Intronic
1088658181 11:112021672-112021694 CCTTAAATGAAGATTTTGTAAGG - Intronic
1088691877 11:112335335-112335357 GCTTAAAGCAAAAACTTCTAAGG + Intergenic
1088741128 11:112768103-112768125 CCTGAATGGAATAACTTGTTTGG + Intergenic
1088755313 11:112880801-112880823 CCTTAGATGAAGAAGTAGTATGG - Intergenic
1093255570 12:16863042-16863064 CCTTAAATTAACAACATGTATGG - Intergenic
1093822005 12:23631937-23631959 CCTTTAAGGAAGAACCTATTAGG - Intronic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1100842721 12:98630081-98630103 TCTTAAAGAAAGAGCTAGTAGGG + Intronic
1101690991 12:107081110-107081132 ACTAGAAGGAAGAACTAGTAAGG + Intronic
1104094127 12:125540975-125540997 CCCTAAAGCAAGACCATGTATGG - Intronic
1107181636 13:37467978-37468000 CCTTAAATGAAAAACTTAGAAGG + Intergenic
1108034120 13:46270157-46270179 TGTCAAAGGAAGATCTTGTAAGG + Intronic
1109441643 13:62382020-62382042 TCTTTAAGGAAGAACTTGGAAGG - Intergenic
1114791432 14:25663298-25663320 TTTTAAAGGAAGAACTTTTTTGG - Intergenic
1116512987 14:45769750-45769772 CCTCAAAGGAAGAGCTTACAGGG + Intergenic
1117130823 14:52685484-52685506 CCTTAAGAGCAGAACTTCTAGGG + Intronic
1125306176 15:38318168-38318190 CCTTTAGGGAAAAACTTCTATGG - Intronic
1126729198 15:51664640-51664662 CATTAAAAGAAAAACCTGTAAGG - Intergenic
1127018651 15:54719188-54719210 CCTTCAAGGGAGATCTTTTAAGG + Intergenic
1129005500 15:72369708-72369730 TCTTAAAAGAAGTACTGGTAAGG + Intronic
1130423927 15:83776257-83776279 ACTTACAGGAAGAACTTCTGAGG - Intronic
1131678916 15:94701368-94701390 CCTTAAAGGAAGGATTGGAAAGG - Intergenic
1134556983 16:15173981-15174003 CCTAAAAGGAAGAACCTTCAAGG + Intergenic
1134917562 16:18085699-18085721 CCTAAAAGGAAGAACCTTCAAGG + Intergenic
1135557622 16:23450276-23450298 CCTTGAAGGAAAACTTTGTAGGG - Intronic
1136510141 16:30732803-30732825 CCTTAAAGGAAGAACTTGTATGG + Intronic
1142703680 17:1680398-1680420 CTTTAAATGGATAACTTGTATGG + Intronic
1147316888 17:39625315-39625337 CCTGAAAGGAAGAAGGGGTATGG - Intergenic
1147352994 17:39866981-39867003 ACTGGAATGAAGAACTTGTAGGG + Intergenic
1147966854 17:44198793-44198815 ATTTAAAGGAAGAACAGGTAAGG - Intronic
1148730973 17:49836359-49836381 GCTGAATGAAAGAACTTGTAAGG + Intergenic
1152520770 17:80855293-80855315 TCTAAAAGCATGAACTTGTAAGG + Intronic
1153811664 18:8757442-8757464 TCTTAAAGGAAGAACCTTTTTGG - Intronic
1155159216 18:23182302-23182324 CCTTGAATGAGGAACTTTTAAGG - Intronic
1155711241 18:28882960-28882982 CATGAAAGGATAAACTTGTAAGG - Intergenic
1156273874 18:35562670-35562692 CCCTAAAGAAAAAAATTGTAAGG + Intergenic
1167334183 19:48874502-48874524 CCTTCAAGAAAGCACTTGCAGGG - Exonic
926860367 2:17302233-17302255 CACCAAAGGAAAAACTTGTATGG + Intergenic
927822456 2:26280322-26280344 CCTGAAAGGAAGAGCTTTTGTGG - Intronic
931239215 2:60437641-60437663 CTTCAAAGGAAGCACTTGGAGGG + Intergenic
932141024 2:69278210-69278232 CCTTAAATGAATAAATTGTATGG + Intergenic
935884557 2:107602846-107602868 CTTTAAAGAAATAACTTTTAAGG + Intergenic
936680910 2:114770162-114770184 CCCTAAAGGCAGCAGTTGTATGG + Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
942191340 2:173473555-173473577 CCTTCAAGGAAGAAAATGAAAGG - Intergenic
943468248 2:188257579-188257601 CCTCTGAGGAAGAACTTTTAAGG + Intergenic
944292770 2:198026571-198026593 ACTTAAAGGAAGAAAAAGTATGG + Intronic
946621186 2:221564741-221564763 TCATAAAGGAAAAACTAGTATGG + Intronic
947609366 2:231514211-231514233 CCTTAAAGGAAAACCTGTTAGGG - Intergenic
1169151343 20:3291964-3291986 CCTTAAAGTAAAAACATGTCTGG - Intronic
1173696408 20:45018609-45018631 CTTTAAATGAACAAATTGTATGG - Intronic
1175032903 20:55973237-55973259 CCTGAAAGGAAGACCTTATCAGG + Intergenic
1178351066 21:31873426-31873448 CCTAAGAGGAAGAACTTTTGGGG + Exonic
949316246 3:2758853-2758875 CCTTAAATGAATGAATTGTATGG - Intronic
949896907 3:8774456-8774478 GCTTATAGGTAGAACTTGCACGG + Intronic
951112843 3:18824960-18824982 CCTTAAAGGTACTTCTTGTAAGG - Intergenic
951634905 3:24763183-24763205 CCTTGAAGGAAGAGGTTGTTGGG - Intergenic
953364525 3:42331698-42331720 AAGTAAAGGAAGCACTTGTAGGG - Intergenic
953785088 3:45905542-45905564 GCCTCAAGAAAGAACTTGTAGGG + Intronic
955424127 3:58769562-58769584 TCTCTGAGGAAGAACTTGTAAGG + Intronic
956198196 3:66674905-66674927 TTTTAAAGAAAGAACTTGAATGG + Intergenic
960818144 3:121695318-121695340 GCATGAAGGAAGAACTTGAAAGG - Exonic
965492746 3:169360036-169360058 TCCTCAAGGAAGAACTTGAAGGG - Intronic
965559634 3:170049091-170049113 CCTTAACGTAAGACCGTGTAAGG + Intronic
966336556 3:178874337-178874359 CCAGAAAGGAAGAACTGGGAGGG + Intergenic
966957491 3:184897996-184898018 CCCTAAAGGAACAACATTTAAGG - Intronic
967425904 3:189327134-189327156 CTATAGAGGAAGAACATGTATGG - Intergenic
971406985 4:26330735-26330757 CTTTAAAGGAAGATATTGTGAGG + Intronic
974451446 4:62067072-62067094 CTTTAAAGTAAGAATTTGAAAGG - Intronic
974845233 4:67343866-67343888 CTTTAAAGAATAAACTTGTAAGG - Intergenic
977190692 4:93997276-93997298 CCTTCAAGCAAGAACTTGGAAGG - Intergenic
978488902 4:109289347-109289369 CATTAAAGAAGGAACTAGTAAGG - Intronic
979113485 4:116789529-116789551 TCATAAAGGCAGAACTTTTATGG - Intergenic
979223404 4:118256502-118256524 TCTAAAAGGGAGAAATTGTAGGG + Exonic
979714155 4:123817052-123817074 TTTTACAAGAAGAACTTGTAAGG + Intergenic
980135389 4:128853701-128853723 ACTTAAAAGAAAGACTTGTATGG + Intronic
981215449 4:142160520-142160542 CCTTCAAGGATCAACTTGTCAGG - Exonic
982442530 4:155453678-155453700 CCTTAGAGTAAAAGCTTGTAAGG + Intergenic
985175311 4:187194138-187194160 CCATAAAGGAACAAATTGAAAGG + Intergenic
986074603 5:4322577-4322599 TCTTAGAGGAAGAAGTTGGAAGG - Intergenic
988815625 5:34831412-34831434 ACTTAAAAAAAGAACTTTTAAGG - Intronic
989545462 5:42667405-42667427 CCTTAAAGGAAAATATTGAAAGG - Intronic
993886077 5:93417100-93417122 CTTTAGAGAAAGATCTTGTAAGG - Intergenic
995549628 5:113267831-113267853 CCTTAAATGGATAAGTTGTATGG + Intronic
995822226 5:116249093-116249115 CTTTAAAGGAAGAATATGAATGG - Intronic
995972088 5:117984874-117984896 GGTTAAGGGAGGAACTTGTACGG - Intergenic
998801257 5:145871947-145871969 CCTTAAAAGAAAATCATGTATGG + Intronic
1000804384 5:165770984-165771006 CATTAAAGGAATAACCTGTCTGG + Intergenic
1004247318 6:13991683-13991705 GCTTAAAGGAAATACCTGTAAGG - Intergenic
1004691651 6:17997455-17997477 CATTAAAGTCAGAACTTGTTGGG + Intergenic
1005701547 6:28405830-28405852 CAATAAAGGAAGAACTTTCAGGG + Intergenic
1006162142 6:32045056-32045078 CCATAGAGGAGGAACCTGTAGGG + Exonic
1011692405 6:89882356-89882378 CATTAAATGAATAACCTGTAAGG - Intergenic
1012711030 6:102604872-102604894 CCTTATGGCAAGAACGTGTAAGG + Intergenic
1014577260 6:123089018-123089040 CCTTATAAGAAGAACTTATAAGG - Intergenic
1015241521 6:131029237-131029259 CACTAAAGGAGGAAGTTGTAAGG - Intronic
1021514344 7:21466465-21466487 CCTCAAAGGAAGAAACTGCAGGG + Intronic
1028230021 7:88295904-88295926 ACTTAGAGGAAAAAATTGTAAGG - Intronic
1028595102 7:92539740-92539762 TGATAAAGGAAGAACATGTAAGG + Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031385728 7:121148625-121148647 CCAGACAGGAAGAACTTGTTGGG + Intronic
1031678142 7:124636287-124636309 CCTTAAAAGAAGAAATTATATGG - Intergenic
1033790698 7:144789817-144789839 TCTTAATGGAAGAATCTGTATGG + Intronic
1036942632 8:13066291-13066313 TCATAAAGGAAGAACTTGTTGGG + Intergenic
1037465776 8:19158765-19158787 CCTTAAAGGAAGAAGTGGGCCGG + Intergenic
1039204560 8:35137044-35137066 TTTTAAAGGAAGAACTGATAGGG - Intergenic
1039613659 8:38938181-38938203 CCTCTCAGAAAGAACTTGTAGGG + Intronic
1040048380 8:42986859-42986881 CCTTAAACAAAGAACTGGCAGGG + Intronic
1041734738 8:61097909-61097931 CCTTTCTGGAAGAACTTTTAGGG - Intronic
1042571584 8:70171249-70171271 CCTTCCAGGAGGTACTTGTAAGG - Intronic
1042797459 8:72680209-72680231 CCCTAAAGGAAGAGCTTACAAGG + Intronic
1050214666 9:3309314-3309336 CCTTCTAGGAAGAACCTGTAGGG + Intronic
1050811520 9:9753867-9753889 TCTTAAGGGAAGAATTTGCATGG - Intronic
1052103779 9:24485572-24485594 CCATAAAGGTAGAAGTTGAAAGG - Intergenic
1055835524 9:80436334-80436356 CTGTAAAGGAAGAACTTTTGTGG + Intergenic
1056083969 9:83126493-83126515 CCTTCAAGGGAAAACCTGTAAGG - Intergenic
1060624142 9:125095042-125095064 CCTTCAAGAAAGAACTTGCTGGG + Intronic
1186305343 X:8250818-8250840 CCATAAAGGAAGAATTAGAATGG + Intergenic
1186639181 X:11437007-11437029 CTTTAAATGAATGACTTGTATGG + Intronic
1187109757 X:16284600-16284622 TATTAAAGTAAGAACTTGCATGG - Intergenic
1187393340 X:18900264-18900286 CCTGGAAGGAAAAACATGTAAGG - Intronic
1187505974 X:19878898-19878920 CCTTAAATGGATAAATTGTATGG + Intronic
1187754978 X:22514115-22514137 ACTTAAAGGAAGAAATAGGAAGG - Intergenic
1188002406 X:24994888-24994910 CTTTAAAAGAACAACATGTAGGG + Intronic
1194369824 X:93058922-93058944 ACTTAAAGGAAGAAATTCTCTGG - Intergenic
1195298246 X:103501082-103501104 CTTTAAAGGAAGGACGGGTATGG + Exonic
1197834437 X:130679383-130679405 CTTTAAAGGAAGAAGTTGAATGG + Intronic
1200678012 Y:6175132-6175154 ACTTAAAGGAAGAAATTCTCTGG - Intergenic