ID: 1136511022

View in Genome Browser
Species Human (GRCh38)
Location 16:30738411-30738433
Sequence CCGTCTGTCCGCAGCATGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 33}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136511014_1136511022 13 Left 1136511014 16:30738375-30738397 CCTGGGGTCTCTGAGACTAGTGC 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 33
1136511017_1136511022 -9 Left 1136511017 16:30738397-30738419 CCAGCCCGGGAAGCCCGTCTGTC 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 33
1136511011_1136511022 27 Left 1136511011 16:30738361-30738383 CCAGCACCCTAGTGCCTGGGGTC 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 33
1136511013_1136511022 20 Left 1136511013 16:30738368-30738390 CCTAGTGCCTGGGGTCTCTGAGA 0: 1
1: 0
2: 2
3: 20
4: 266
Right 1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 33
1136511012_1136511022 21 Left 1136511012 16:30738367-30738389 CCCTAGTGCCTGGGGTCTCTGAG 0: 1
1: 0
2: 1
3: 15
4: 215
Right 1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136511022 Original CRISPR CCGTCTGTCCGCAGCATGTC AGG Exonic