ID: 1136511673

View in Genome Browser
Species Human (GRCh38)
Location 16:30741688-30741710
Sequence AAGGCCAAGGGCTCTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136511665_1136511673 21 Left 1136511665 16:30741644-30741666 CCATGAGAACAGAATGCTCTGAG 0: 1
1: 0
2: 0
3: 28
4: 284
Right 1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG 0: 1
1: 0
2: 1
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136511673 Original CRISPR AAGGCCAAGGGCTCTGTTGT TGG Intronic
900118453 1:1038577-1038599 ATGGCCAAGGGCACTGTTCCTGG - Intronic
902564910 1:17305066-17305088 AGGGCCACGGGCTCTGTGATGGG - Intergenic
902822610 1:18952345-18952367 CAGGCCAGGGGCTCTGGTTTGGG + Intronic
904321263 1:29698953-29698975 AAGGGCATGTGCTCTGTTATAGG + Intergenic
904948296 1:34215231-34215253 AAGTGCAAGGGCTCTGAGGTGGG + Intronic
905346109 1:37312186-37312208 AAGGTCAAGGGCTAGGTTTTTGG - Intergenic
906774037 1:48512539-48512561 AAGGGCATGGGCTCTGGAGTTGG + Intergenic
907972206 1:59394050-59394072 AAGGAAAAGGGATCTGTTGGGGG + Intronic
908688605 1:66752416-66752438 AGGGCCGAGGGCTCTGTTTGAGG + Intergenic
911149062 1:94579827-94579849 AAGGCCAAGTCCTCTGCTGGGGG + Intergenic
913066438 1:115260175-115260197 AAGACCAAAGGCTCTGAAGTTGG + Intergenic
915921010 1:159974999-159975021 AAACCCAAGTGCTCTGTGGTTGG - Intergenic
918971593 1:191426937-191426959 AAGGTTAGGGGCTCTGCTGTAGG - Intergenic
919169832 1:193939487-193939509 AGGCCCAAGGGCTCTTTAGTTGG - Intergenic
919822140 1:201480356-201480378 AAGGCCAGGGGATCTCTGGTGGG + Intergenic
920498468 1:206471551-206471573 AAGGCCAAGGGCTCTGATACTGG - Intronic
921783728 1:219200571-219200593 AAGGCCAAGGGTTGTGGTGATGG - Intronic
923695067 1:236240731-236240753 GAGGGCAAGGGCTTTGTTTTTGG - Intronic
923814184 1:237357367-237357389 AAGACAGAGGGCTATGTTGTAGG - Intronic
924218403 1:241848489-241848511 CAGGCTAAGGGCTCCGCTGTTGG - Intronic
1065854160 10:29816113-29816135 AAAGCCATGAGCTCTGGTGTGGG - Intergenic
1066506063 10:36045249-36045271 AAGACCAGGTGGTCTGTTGTTGG + Intergenic
1068921556 10:62489805-62489827 AAGACCAAGAGCTCAGTTTTGGG + Intronic
1069836263 10:71310268-71310290 CAGGCCAAGGGCTGGGTTGTTGG - Intergenic
1074833230 10:117264247-117264269 ATGGCCCAGGGCACTGTTGCAGG + Intronic
1075094194 10:119460526-119460548 AAAGCCAAGGCCTCTGTGCTGGG - Intergenic
1075613570 10:123874283-123874305 AAGGCCAAGGGAGCTCTTGGGGG + Intronic
1081406503 11:42704896-42704918 AAGAGCAAGGACTCTGTAGTAGG + Intergenic
1081760728 11:45574987-45575009 AGGGCGAGGGGCACTGTTGTAGG - Intergenic
1081761136 11:45577093-45577115 AGGGACAAGGACCCTGTTGTGGG - Intergenic
1081921482 11:46781606-46781628 AATGCCAAAAGCTCTGTGGTAGG - Intronic
1082988510 11:59187607-59187629 AAAGCCAACAGCTCTGCTGTGGG - Intronic
1084209756 11:67615498-67615520 AAGGCCTAGGTCTCAGTTGCTGG - Intergenic
1084235598 11:67786140-67786162 AAGGCCGACGGCTCTGTGGCTGG - Intergenic
1086157517 11:83683889-83683911 AGGGCCCAGGGCTCTGTGCTGGG + Intronic
1089771047 11:120803246-120803268 TATGCTAAGGGCGCTGTTGTGGG + Intronic
1089946559 11:122479982-122480004 AAGCCCAAGGACTCTTTAGTCGG - Intergenic
1090485811 11:127110952-127110974 AAGGCGAAGGACTTTGTTTTGGG - Intergenic
1090973986 11:131666681-131666703 GAGGCTGAGGACTCTGTTGTGGG - Intronic
1092599582 12:10044801-10044823 AAAGCCAAGGGCTTTCCTGTTGG - Intronic
1092830069 12:12435275-12435297 AAGGTCAGGAGCTCTGTTCTTGG + Intronic
1093487237 12:19665254-19665276 ATGGCCAAGGGCTTTGTGGAAGG + Intronic
1093981616 12:25481059-25481081 AAGCCCAAAGACTCTGTGGTGGG - Intronic
1095764782 12:45882233-45882255 AAGGCCCAGGTCTCCTTTGTGGG + Intronic
1095771650 12:45966315-45966337 AAGGCCCAGTGATCTTTTGTGGG + Intronic
1096537965 12:52287418-52287440 AAGGCAAGAGGCTCTGTTCTGGG - Intronic
1096540809 12:52305942-52305964 AAGGCAAGAGGCTCTGTTCTGGG + Intronic
1100524678 12:95408199-95408221 AGGGCCAGGGGCTCTGTTTGAGG + Intergenic
1103612750 12:122133936-122133958 AAGGACACGGGCTCTGGTTTGGG - Exonic
1108742055 13:53348392-53348414 GAGGGCAAGGGCTTTGTTCTAGG + Intergenic
1112338116 13:98531355-98531377 AAAACCAAGTGCTCTTTTGTGGG + Intronic
1115525149 14:34272432-34272454 AAGGCCAAGGGAGCTCTTCTGGG + Intronic
1116033833 14:39604488-39604510 AAGGCCAAGAAATCTGTTGGAGG + Intergenic
1117162361 14:53002047-53002069 TGGGCCTAGGGCTGTGTTGTCGG - Intergenic
1119860732 14:77934099-77934121 AAGGCCAGGGGCTGTTTGGTGGG + Intronic
1120426212 14:84351257-84351279 AGGCCCAAGGGCTCTTTAGTTGG - Intergenic
1121659416 14:95623962-95623984 AAGGGCAAGGGGTCTCTTTTGGG + Intergenic
1122017359 14:98807640-98807662 AGGGCCATGGGATCTTTTGTGGG - Intergenic
1122018459 14:98817090-98817112 AAAGCCAAGGGCACTGTGGGAGG - Intergenic
1122562857 14:102629175-102629197 AAGGCCATGGGCTATGTGGATGG - Intronic
1122859069 14:104574164-104574186 AAGGACAGGGGCTCTGTAGGGGG - Intronic
1124145830 15:27124377-27124399 AAGGCCAGTGGCTCTGCTGCTGG + Intronic
1125233981 15:37490517-37490539 AAGACCTAGGACTCTGTTCTGGG - Intergenic
1125457924 15:39879639-39879661 AAGGCCAAGGTCTGTGAGGTAGG - Intronic
1128776035 15:70321279-70321301 ACTGCCAAGGGCTCTGTGGAGGG + Intergenic
1128885974 15:71288575-71288597 AAGGGCAAGGGCTCCTTTCTGGG + Intronic
1130646082 15:85728501-85728523 AAGGGCAAGGGCTCTTTTTAAGG - Intronic
1132324887 15:100960611-100960633 AAGGGCATGGTTTCTGTTGTGGG + Intronic
1132571374 16:645820-645842 AGGGCCATGGACTCTGTTGTTGG + Intronic
1134544214 16:15095177-15095199 AACGCCAGTGGCTCTTTTGTTGG - Intronic
1136409458 16:30067632-30067654 AAATCCAAGGGCGGTGTTGTGGG + Exonic
1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG + Intronic
1136997179 16:35198559-35198581 AAGGCCACGGGCCCTGCTGCTGG - Intergenic
1137412140 16:48237824-48237846 GGGGCCAAGGGCACTGTTGTAGG - Intronic
1137673104 16:50290947-50290969 AAGGCCAAGGGGTCAGTGCTGGG + Intronic
1140678086 16:77353625-77353647 AAGGCCAAGGGTTAGGTTCTGGG - Intronic
1141707337 16:85674197-85674219 AGGGCCAAGGGCTCGGCTGCTGG - Exonic
1141801372 16:86311605-86311627 CAGGCCCAGGGCTCTGGGGTAGG + Intergenic
1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG + Intronic
1144214987 17:13047355-13047377 AGGGCCCTGGACTCTGTTGTGGG + Intergenic
1147328101 17:39679727-39679749 AGGGCTAGGGGCTCTGATGTAGG - Intronic
1148848119 17:50540963-50540985 AGGGCCCAGGGGTCTGTGGTGGG - Exonic
1149261019 17:54879448-54879470 GTGCCCAAGGGCTCTGTTCTGGG - Intergenic
1150156792 17:62860666-62860688 AAGGTCCAGGGATCTGTTCTAGG + Intergenic
1153373050 18:4342234-4342256 AAGTTCAGGGGCTCTGTTGTAGG - Intronic
1155627249 18:27848743-27848765 AAGGCCAACGGCTCTGGTAATGG + Intergenic
1155968080 18:32054649-32054671 CTGCCCAAGGGCTCTGTTGTAGG + Intronic
1157709894 18:49843016-49843038 AAAGCCGAGGACTCTGGTGTAGG - Intronic
1157892265 18:51428891-51428913 ATGGCCAAGGGCTTAGTTCTTGG + Intergenic
1159995052 18:74956319-74956341 AAGAGCAGGGTCTCTGTTGTGGG - Intronic
1162671278 19:12259812-12259834 AAGGTCAAGCTCTCTGTTGTGGG + Intronic
1166511045 19:43408644-43408666 AAGACCAAGGTCTCTGGTGCAGG - Intronic
1167906447 19:52664734-52664756 AAGGACAAGGGGCCTGGTGTGGG + Intronic
928825150 2:35411712-35411734 ATGGTCAAGAGCTCTTTTGTAGG - Intergenic
929110226 2:38400126-38400148 AAGGTCAAGGGCTGTGTTGTAGG - Intergenic
930735171 2:54771008-54771030 AAGGTCAAAGGCTCTGTTTTGGG + Intronic
931701605 2:64913572-64913594 AAGGCCAAGGGCTCCCTGGGAGG + Intergenic
932482461 2:72053932-72053954 AAGGCCCAAGCCTCTGTTTTGGG - Intergenic
932896715 2:75647121-75647143 AAGGCCCAGTGCTCTGCTGCCGG - Exonic
933607025 2:84393918-84393940 AAGGCCATGAGCTCTGCTTTTGG - Intergenic
933932940 2:87173063-87173085 AAGTCCAAGGGCCATGTGGTGGG - Intergenic
935621658 2:105135397-105135419 TGGGCGAAGGTCTCTGTTGTAGG - Intergenic
936360174 2:111792382-111792404 AAGTCCAAGGGCCATGTGGTGGG + Exonic
936497596 2:113035908-113035930 AATGGTCAGGGCTCTGTTGTTGG + Intronic
938130812 2:128714477-128714499 AAGCCCAGGGGCTATGGTGTGGG + Intergenic
938164856 2:129017623-129017645 AAACCCAAGGACTCTGTTCTGGG - Intergenic
938893994 2:135732943-135732965 AAGGCCAGGGGCTCTATGGCAGG + Intergenic
939903390 2:147879274-147879296 AAGGCAAAGGCATCTGGTGTGGG + Intronic
943035366 2:182738369-182738391 AAGGCAAGAGGCTCTATTGTTGG - Intronic
943451288 2:188045193-188045215 AAGCCCAAGGGCTTTGTAGAAGG + Intergenic
946666275 2:222053099-222053121 GAGACCAAGAGATCTGTTGTTGG + Intergenic
947115153 2:226762036-226762058 ATGAGCAAGGGCTATGTTGTAGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948006188 2:234609769-234609791 AAGGACAAGGACTCTGCTATTGG - Intergenic
948280561 2:236744453-236744475 TTGGCCAAGGTGTCTGTTGTGGG - Intergenic
949062884 2:241971465-241971487 AGGACCAAGGGCACTGCTGTGGG + Intergenic
1169107858 20:3012499-3012521 GGGCCCAAGGGCTCTGTTCTTGG - Intronic
1169205992 20:3740688-3740710 AAGGCAAAGGGCTCTCTGCTGGG - Intronic
1171248127 20:23629623-23629645 AAGTCCAAAGGCTCCTTTGTGGG - Intronic
1172700587 20:36851510-36851532 AAGGCCAAAGGCTTTGAGGTGGG - Intronic
1173404434 20:42752605-42752627 AGGGCCAAGTGCTGTGTTATGGG - Intronic
1176449425 21:6849998-6850020 TAGACCAAGGACTCTGTGGTGGG + Intergenic
1176827595 21:13715022-13715044 TAGACCAAGGACTCTGTGGTGGG + Intergenic
1179542836 21:42094720-42094742 AAGGCCAATCTCTCTTTTGTTGG - Intronic
1179799650 21:43804931-43804953 AAGGCCAGGGCCCCTGTTCTAGG + Exonic
1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG + Intronic
1180994675 22:19959592-19959614 AGGGGCCAGGGCTCTGTTGGTGG + Intronic
1182241744 22:28921415-28921437 GAGGCAAGGGGCTCTGTGGTTGG - Intronic
1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG + Intronic
1183094609 22:35544513-35544535 ATGGCAAAGGGCTCTGTCTTTGG - Intronic
1183233183 22:36595858-36595880 AAGGCCAAGGGCTGTGCCGTGGG + Intronic
1183708630 22:39489749-39489771 AAGGCCAAGAGTCCAGTTGTAGG + Exonic
1183877372 22:40795194-40795216 AAGGGCAAGGGATCTGCAGTGGG - Intronic
1184553473 22:45218656-45218678 AAGGATATGGGCTCTGTTGGAGG - Intronic
1185277407 22:49955784-49955806 AAGGCCAAGAGCTATGAAGTGGG + Intergenic
949671848 3:6406592-6406614 TAGGCCAAGTGCTCTTTTGGGGG - Intergenic
949909490 3:8889615-8889637 AAGTTCAAAGGCTCTGTGGTGGG + Intronic
951295485 3:20928410-20928432 AAAGCCAAAGGCTCTGTAGAAGG - Intergenic
951737325 3:25882290-25882312 AAGGCCAAGAGCTCTATGGTAGG - Intergenic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
953943447 3:47123995-47124017 AAGGCCACTGGCTCTGTTACTGG + Exonic
957051569 3:75415937-75415959 AAGGCCAACCGCTCTGTGGCTGG - Intergenic
957480284 3:80783773-80783795 AAGGCCAATGGCTACATTGTGGG + Intergenic
957824550 3:85423393-85423415 AAGGACAAGGACTCTGGTGAGGG - Intronic
961041552 3:123682042-123682064 AAGGCCACTGGCTCTGTTATTGG + Intronic
962204080 3:133420945-133420967 AGGGCCAGGGCCTCTCTTGTGGG - Intronic
963327681 3:143880347-143880369 GAGGGCAAGGGCTCTGTTTTTGG - Intergenic
965189958 3:165515231-165515253 AAGTCCAAGAGACCTGTTGTGGG + Intergenic
966599792 3:181763777-181763799 AAGTGCAAAGGCTCTGTGGTAGG + Intergenic
966805905 3:183807287-183807309 CTGCCCAAGGGCTCTGATGTGGG - Intronic
966882346 3:184357569-184357591 GAGGCCAAGGGCAGGGTTGTGGG + Intronic
969166694 4:5322274-5322296 AAGGCCGAGCGCTCCATTGTTGG + Intronic
970314358 4:14815241-14815263 AAGGCTAGGGGCTGTGTTTTGGG + Intergenic
972838721 4:42906351-42906373 AAAGCCAAGTGCGCTGTGGTGGG - Intronic
974298647 4:60036531-60036553 AGAGCCAAGAGCTCTGTTGGAGG - Intergenic
977222148 4:94350551-94350573 AAGACCAAGGGATTTGTTGGTGG - Intergenic
978385728 4:108173498-108173520 AAGGCCAAGGGTTCTCTTCCGGG + Intergenic
980108054 4:128607425-128607447 ATGGGCAAAGGCTCTGTGGTAGG + Intergenic
990171069 5:53050348-53050370 AAGTCCTGGGGCTCTGTCGTGGG + Intronic
993490487 5:88540619-88540641 AAACCCCAGGGCTCTGTTCTGGG - Intergenic
993971130 5:94421303-94421325 AAGGCTAAGGCCACTGTTCTGGG - Intronic
994428771 5:99628453-99628475 AGGGCCCAGGGCTCTTTAGTTGG + Intergenic
996411246 5:123161781-123161803 TAGGCAAAGGGAGCTGTTGTAGG + Intronic
998282426 5:140824065-140824087 AAGGCCATGAGGTCTGTTTTGGG - Exonic
998337690 5:141388005-141388027 ATGCCCAAGGGCTCCGTAGTGGG + Exonic
998338800 5:141398248-141398270 ATGCCCAAGGGCTCCGTAGTGGG + Exonic
998339927 5:141408323-141408345 CTGGCCAAGGGCTCGGTGGTGGG + Exonic
998341010 5:141417980-141418002 CTGGCCAAGGGCTCGGTGGTGGG + Exonic
998875532 5:146595178-146595200 AATGCCAAGAGCACTGCTGTAGG - Intronic
999949782 5:156636405-156636427 AAAGCCAAGGACCCTGTTATGGG - Intronic
1001092591 5:168752265-168752287 ATGTCCAAGGGCCCTGTGGTTGG - Intronic
1002688794 5:181036540-181036562 AAGCTCAAGGGCCATGTTGTGGG + Intergenic
1003366868 6:5483299-5483321 AAAGACAAGGACTTTGTTGTAGG - Intronic
1003445908 6:6184294-6184316 AAGGCCAAGGGCCAGGTTATGGG - Intronic
1013262624 6:108461253-108461275 AGGGGGAAGGGCTCTGTGGTGGG + Intronic
1015333745 6:132010895-132010917 AAGACCAAGGACTGTGTTGTGGG + Intergenic
1015642612 6:135351930-135351952 AAGGCCCAGGCCTAGGTTGTGGG - Intronic
1016214484 6:141580608-141580630 AATGCCAAGGGAACTGTTTTAGG + Intergenic
1021243569 7:18234797-18234819 AAGGCCAAGGATTCTGTTGCAGG + Intronic
1024117950 7:46210713-46210735 GAGGCCCAGGGCTCTCTTGCCGG - Intergenic
1029344702 7:99970129-99970151 AATGCCAAGAGCACTGTTTTAGG + Intronic
1030305199 7:108010872-108010894 AAGGCCAAGGGCATTATGGTTGG - Intergenic
1032702595 7:134395800-134395822 AAGTGCAAGGGCCCTGTGGTTGG + Intergenic
1033037126 7:137885307-137885329 AAGGCCAAGTGCTGTGCTGTAGG - Intronic
1034124909 7:148662758-148662780 ATGTCCAAGGGCCCTGTGGTGGG + Intergenic
1035749002 8:1982503-1982525 AAGGCCAGTGGGTCTCTTGTAGG - Intronic
1035868353 8:3109623-3109645 AAGGCCTTGGGCTTTGTTCTTGG - Intronic
1038653044 8:29422911-29422933 AAGGCCAAGGGGTTTGGGGTAGG + Intergenic
1039450801 8:37673576-37673598 AAGGCCAAGGGATATGTGGGAGG - Intergenic
1039781927 8:40794592-40794614 CAGGCCACGTGCTCTGCTGTTGG - Intronic
1044944596 8:97378771-97378793 AAAGCCAATGACTCTGTTCTTGG - Intergenic
1045800698 8:106097363-106097385 AGGGCCAAGGGCTCTTTAGTTGG - Intergenic
1049154207 8:141056976-141056998 AGGGCCAAGGGCTCAGTGCTGGG + Intergenic
1051721948 9:20046423-20046445 AATGCCAAGGGCTTTTTTATGGG + Intergenic
1054864036 9:69981660-69981682 AATTCCAAGTGCTCTGTTGAAGG + Intergenic
1057468760 9:95339104-95339126 AGGGGCAAGGGCTCTCTTTTAGG + Intergenic
1057699793 9:97355679-97355701 AAGGCCATAAGCTCTGGTGTCGG - Intronic
1058450108 9:105088661-105088683 AATGCCAAGGTTTCTGCTGTCGG - Intergenic
1059026137 9:110633265-110633287 AAGGTCATGGGCCCTGTTGGTGG + Intergenic
1059637125 9:116182009-116182031 AAGGCCAAATGTTTTGTTGTAGG - Intronic
1059759223 9:117322628-117322650 AAGGCAGAGGGCTCTGTCTTTGG - Intronic
1060248259 9:121964721-121964743 AAGGCACAAGGCTCTGTTGGGGG - Intronic
1060438148 9:123613941-123613963 AAGGAAAAGGGCTCTGTTGCTGG + Intronic
1060477482 9:123997355-123997377 GAGGCAAAGGGCTCTGTAGTGGG - Intergenic
1060716324 9:125933181-125933203 AAGGCAAGGGGCTCTGCTCTAGG + Intronic
1060992611 9:127857515-127857537 AAGGCCCTGGGCTCTGTGCTGGG - Intergenic
1203519762 Un_GL000213v1:34519-34541 TAGACCAAGGACTCTGTGGTGGG - Intergenic
1186507946 X:10109198-10109220 ATGGCCAGGGGCTCTGGTGCAGG + Intronic
1187082354 X:16004374-16004396 ATGGCCAAGGCATCTGTTCTTGG - Intergenic
1192958816 X:76104358-76104380 AAGCCCAAGGACTCTTTAGTTGG + Intergenic
1194067359 X:89277669-89277691 AAGGTCAAGAGCCCTGTTATGGG + Intergenic
1194844232 X:98783646-98783668 AAGGCAAAGGGCCCTTTTGAAGG + Intergenic
1195196698 X:102503911-102503933 AAGATCAAGGCATCTGTTGTGGG + Intergenic
1195713212 X:107792094-107792116 AGAGCCAAAGGCTCTGTTATTGG - Intronic
1198201418 X:134422892-134422914 CAGGACAAGTGCTTTGTTGTTGG - Intronic
1200039634 X:153355819-153355841 AATGCCATGGGCTCTGTGGCTGG - Intronic
1200051366 X:153433517-153433539 AATGCCAAGGGTTCTTTTGCCGG + Intergenic