ID: 1136512518

View in Genome Browser
Species Human (GRCh38)
Location 16:30748126-30748148
Sequence GACCCGGAAGTTGGGTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136512518 Original CRISPR GACCCGGAAGTTGGGTTTAC TGG (reversed) Intergenic
902768037 1:18630056-18630078 CAGCAGGTAGTTGGGTTTACAGG - Intergenic
903244597 1:22006291-22006313 GACCATGAAGTTGGGCTTCCTGG + Intronic
912553828 1:110501653-110501675 GACCAGGAAGCAGGGATTACTGG - Intergenic
912653933 1:111468649-111468671 GACCTGAAGGTTGGGTTTAAAGG - Intergenic
1065031861 10:21594423-21594445 GACCCAGTAGCTGGGATTACAGG - Intronic
1071574509 10:86715820-86715842 GACCTGGTAGCTGGGTTTTCAGG - Intronic
1073447441 10:103589992-103590014 GCCCTGGAAGTTGGGTTGTCAGG + Intronic
1090518706 11:127456137-127456159 CACCCAGAAGTTGGGATTGCTGG + Intergenic
1101625358 12:106435265-106435287 GACCCAGTAGCTGGGATTACAGG + Intronic
1110535961 13:76651136-76651158 GCCCAGGTAGTTGGGATTACAGG - Intergenic
1112666549 13:101581391-101581413 CACCTGGAAGTTAGGTTTATGGG - Intronic
1118108318 14:62686789-62686811 TCCCCGGTAGTTGGGATTACAGG - Intergenic
1119062699 14:71492377-71492399 GAGCCAGAAGTGGGGTTTACAGG + Intronic
1123841255 15:24249594-24249616 GCCCCAGTAGTTGGGATTACAGG - Intergenic
1129092545 15:73166620-73166642 GATCTTGAAGTGGGGTTTACAGG + Intronic
1130333269 15:82937806-82937828 GACCCAGAAGGTGGGTGCACAGG - Intronic
1131360512 15:91786324-91786346 GACACGTAAGTTGGGATTATTGG - Intergenic
1132874875 16:2132442-2132464 TACCTGGTAGCTGGGTTTACAGG - Intronic
1134520116 16:14914939-14914961 TACCTGGTAGCTGGGTTTACAGG + Intronic
1134553817 16:15151292-15151314 TACCTGGTAGCTGGGTTTACAGG - Intergenic
1134707790 16:16313593-16313615 TACCTGGTAGCTGGGTTTACAGG + Intergenic
1134959753 16:18398533-18398555 TACCTGGTAGCTGGGTTTACAGG - Intergenic
1136512518 16:30748126-30748148 GACCCGGAAGTTGGGTTTACTGG - Intergenic
1140065254 16:71606015-71606037 TACCCGGTAGCTGGGATTACAGG - Intergenic
1148586509 17:48784971-48784993 GATGCTGAAGTTGGGTTTACTGG + Exonic
1150341754 17:64374089-64374111 CACCAGGAAGTTGGGTTTGGAGG - Intronic
1151132489 17:71912044-71912066 GACTAGGAAGTAGTGTTTACAGG + Intergenic
1151284148 17:73097621-73097643 TCCCCAGAAGTTGGGATTACAGG - Intergenic
1152347964 17:79765618-79765640 TACCCAGTAGTTGGGATTACAGG - Intergenic
1152637716 17:81436950-81436972 GACCCAGAGCTTGGGTTTCCTGG + Intronic
1154222713 18:12471166-12471188 GACACTGAAGTTAGGTTTCCAGG + Intronic
1156261231 18:35446499-35446521 GACCCAGTAGCTGGGATTACAGG - Intronic
1156314354 18:35953277-35953299 TACCCAGAAGTGGGGTTTGCTGG - Intergenic
1163100381 19:15092295-15092317 GACAGGGAAGCTGGGTTTGCAGG + Intergenic
1167541377 19:50090028-50090050 GACCCAGTAGCTGGGATTACAGG - Intergenic
1167628714 19:50609481-50609503 GACCCAGTAGCTGGGATTACAGG + Intergenic
1167807087 19:51795125-51795147 GCCAAGGAAGTTGGTTTTACAGG - Intronic
1168527252 19:57099136-57099158 GCCCCCAAATTTGGGTTTACGGG - Intergenic
925382090 2:3435573-3435595 AGCCCGGAAGTTGGGTTTGTTGG + Intronic
927542210 2:23922987-23923009 TACCCAGAAGTTGGGATTGCTGG - Intronic
927828075 2:26323559-26323581 GCCCAGGTAGTTGGGATTACAGG + Intronic
927981951 2:27380080-27380102 GACTCGGAAGGTGGGTTTTCGGG - Exonic
932875536 2:75447299-75447321 TACCGGGAAGTAGGGATTACTGG + Intergenic
935367562 2:102310380-102310402 GGCCAGGATGTTGGGATTACAGG + Intergenic
935376145 2:102399723-102399745 GACTCGCCAGTTGGGTTTGCTGG + Intergenic
945348129 2:208744073-208744095 GACTTGGAGGTTTGGTTTACAGG + Intronic
945428139 2:209733190-209733212 GACCCAGAGGTTGAGTTCACTGG - Exonic
946680406 2:222208891-222208913 TACATGGAAGTTCGGTTTACAGG - Intronic
1169540361 20:6593095-6593117 TCCCAGGAAGTTGGGTCTACAGG + Intergenic
1174563233 20:51446009-51446031 AACCAGGAAGTTGGGGTTTCAGG + Intronic
1175457018 20:59123241-59123263 GGCCCAGATGTTGGGTTTAAGGG + Intergenic
1177704912 21:24690317-24690339 GCCTCAGTAGTTGGGTTTACAGG - Intergenic
1180661522 22:17471657-17471679 TCCCCGGTAGTTGGGATTACAGG + Intronic
1182001503 22:26923611-26923633 GACCCAGAATGTGGGTTTCCTGG + Intergenic
1183519862 22:38290619-38290641 GACCCGGAAGTGGGTCTTGCTGG - Intergenic
950295457 3:11825871-11825893 AGCCTGGAAGTTGGGATTACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
954429965 3:50465400-50465422 GACCCGGAAGCTGGGTCAAGTGG - Intronic
957969249 3:87362114-87362136 GAGACGGAAGTTGTGGTTACAGG + Intergenic
958974734 3:100654528-100654550 TACCAGGAAGTAGGGTTCACTGG + Intronic
959924990 3:111910987-111911009 GAACAGGAAGTTTGGTCTACTGG - Intronic
960357538 3:116672197-116672219 GACCAGGAATTGGGGTTTTCTGG - Intronic
969571191 4:8009517-8009539 CACCCGGTAGCTGGGATTACAGG + Intronic
972504452 4:39707328-39707350 GACCCAGTAGCTGGGATTACAGG + Intronic
996187693 5:120499231-120499253 GCCCCAGTAGTTGGGATTACAGG + Intronic
1005740859 6:28789259-28789281 GCCTCGGCAGGTGGGTTTACAGG - Intergenic
1006608176 6:35274646-35274668 GCCCAGGAGGTTGAGTTTACAGG + Intronic
1017360933 6:153570550-153570572 GCCCCAGAAGCTGGGATTACAGG + Intergenic
1027183977 7:75959083-75959105 GAGCAGGAAGTTGGGTGTAGTGG + Intronic
1031024093 7:116661714-116661736 GACCCGTGAGATAGGTTTACCGG + Intergenic
1032466037 7:132145810-132145832 CTCCCAGAAGTTGGGATTACAGG - Intronic
1036581773 8:10081753-10081775 GTCCCGGGAGATGGGATTACAGG + Intronic
1042282520 8:67069781-67069803 CCCCCGGTAGTTGGGATTACAGG + Intronic
1046672218 8:117068698-117068720 GCCCAGGTAGTTGGGATTACAGG + Intronic
1046748469 8:117901026-117901048 GACCAGAAAGCTGGCTTTACTGG - Intronic
1047292176 8:123540757-123540779 GACCCGGAGGGTGGGACTACGGG - Intronic
1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG + Intergenic
1053602330 9:39623620-39623642 GAACTGGCAGTTGGGTTTTCAGG - Intergenic
1053859983 9:42377346-42377368 GAACTGGCAGTTGGGTTTTCAGG - Intergenic
1054251205 9:62718815-62718837 GAACTGGCAGTTGGGTTTTCAGG + Intergenic
1054565316 9:66753328-66753350 GAACTGGCAGTTGGGTTTTCAGG + Intergenic
1058235380 9:102484741-102484763 GACCTGGAAGCTGGGACTACAGG - Intergenic
1058235403 9:102484883-102484905 GACCTGGAAGTTTGGTCTGCAGG - Intergenic
1062093529 9:134690832-134690854 CACCCGGAAGCTGGGATGACAGG - Intronic
1187067546 X:15855045-15855067 GACCCGGAAGCGGCGTTTGCCGG + Intergenic
1188403654 X:29779525-29779547 GTCACGGGAGTTGGGTGTACAGG - Intronic
1190178988 X:48175489-48175511 TACCCAGTAGTTGGGATTACAGG + Intergenic
1190197832 X:48334897-48334919 TACCCAGTAGTTGGGGTTACAGG + Intergenic
1190664577 X:52685331-52685353 TACCCAGTAGTTGGGGTTACAGG + Intronic
1190674845 X:52773087-52773109 TACCCAGTAGTTGGGGTTACAGG - Intronic
1194129726 X:90066521-90066543 CACACGGAAGTTGGCTTTGCAGG + Intergenic
1196566481 X:117210590-117210612 GGCCTGGAATTTGGGTCTACAGG - Intergenic
1198340805 X:135711955-135711977 TCCCCAGAAGTTGGGATTACAGG - Intergenic