ID: 1136512690

View in Genome Browser
Species Human (GRCh38)
Location 16:30748726-30748748
Sequence GCCCCCGGGAGCCGCCATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 22 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136512684_1136512690 -4 Left 1136512684 16:30748707-30748729 CCCCAGCTGCAAGGGCTGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 199
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512668_1136512690 22 Left 1136512668 16:30748681-30748703 CCCCCCCACCCCCCAGGACCCTG 0: 1
1: 2
2: 18
3: 204
4: 1428
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512673_1136512690 18 Left 1136512673 16:30748685-30748707 CCCACCCCCCAGGACCCTGGCGC 0: 1
1: 0
2: 1
3: 31
4: 381
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512679_1136512690 10 Left 1136512679 16:30748693-30748715 CCAGGACCCTGGCGCCCCAGCTG 0: 1
1: 0
2: 6
3: 30
4: 358
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512669_1136512690 21 Left 1136512669 16:30748682-30748704 CCCCCCACCCCCCAGGACCCTGG 0: 1
1: 1
2: 10
3: 124
4: 977
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512686_1136512690 -6 Left 1136512686 16:30748709-30748731 CCAGCTGCAAGGGCTGCGCCCCC 0: 1
1: 0
2: 1
3: 29
4: 306
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512665_1136512690 27 Left 1136512665 16:30748676-30748698 CCACCCCCCCCCACCCCCCAGGA 0: 2
1: 8
2: 100
3: 888
4: 12269
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512661_1136512690 30 Left 1136512661 16:30748673-30748695 CCCCCACCCCCCCCCACCCCCCA 0: 4
1: 39
2: 324
3: 3298
4: 13735
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512678_1136512690 11 Left 1136512678 16:30748692-30748714 CCCAGGACCCTGGCGCCCCAGCT 0: 1
1: 1
2: 2
3: 37
4: 333
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512677_1136512690 12 Left 1136512677 16:30748691-30748713 CCCCAGGACCCTGGCGCCCCAGC 0: 1
1: 0
2: 4
3: 32
4: 389
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512666_1136512690 24 Left 1136512666 16:30748679-30748701 CCCCCCCCCACCCCCCAGGACCC 0: 1
1: 6
2: 37
3: 499
4: 3708
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512685_1136512690 -5 Left 1136512685 16:30748708-30748730 CCCAGCTGCAAGGGCTGCGCCCC 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512681_1136512690 4 Left 1136512681 16:30748699-30748721 CCCTGGCGCCCCAGCTGCAAGGG 0: 1
1: 0
2: 2
3: 24
4: 208
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512675_1136512690 14 Left 1136512675 16:30748689-30748711 CCCCCCAGGACCCTGGCGCCCCA 0: 1
1: 0
2: 4
3: 44
4: 347
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512683_1136512690 3 Left 1136512683 16:30748700-30748722 CCTGGCGCCCCAGCTGCAAGGGC 0: 1
1: 0
2: 2
3: 21
4: 264
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512676_1136512690 13 Left 1136512676 16:30748690-30748712 CCCCCAGGACCCTGGCGCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 401
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512674_1136512690 17 Left 1136512674 16:30748686-30748708 CCACCCCCCAGGACCCTGGCGCC 0: 1
1: 0
2: 3
3: 75
4: 578
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512671_1136512690 20 Left 1136512671 16:30748683-30748705 CCCCCACCCCCCAGGACCCTGGC 0: 1
1: 0
2: 12
3: 114
4: 1053
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512663_1136512690 28 Left 1136512663 16:30748675-30748697 CCCACCCCCCCCCACCCCCCAGG 0: 1
1: 4
2: 53
3: 598
4: 3920
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512662_1136512690 29 Left 1136512662 16:30748674-30748696 CCCCACCCCCCCCCACCCCCCAG 0: 2
1: 14
2: 138
3: 1212
4: 9520
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512672_1136512690 19 Left 1136512672 16:30748684-30748706 CCCCACCCCCCAGGACCCTGGCG 0: 1
1: 0
2: 3
3: 54
4: 460
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1136512667_1136512690 23 Left 1136512667 16:30748680-30748702 CCCCCCCCACCCCCCAGGACCCT 0: 2
1: 3
2: 22
3: 254
4: 1940
Right 1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG 0: 1
1: 0
2: 1
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136512690 Original CRISPR GCCCCCGGGAGCCGCCATGC GGG Intronic
900245257 1:1633493-1633515 GCCCGTGGGAGCCCCCATCCCGG + Intronic
900256488 1:1700652-1700674 GCCCGTGGGAGCCCCCATCCCGG + Intronic
900380189 1:2380090-2380112 GTCCCCAGAAGCCTCCATGCTGG - Intronic
900383181 1:2395476-2395498 GGCCCCAGGAGCAGCCTTGCTGG - Intronic
900513443 1:3070641-3070663 GGCCCCGGGAGCTGCGAGGCCGG - Intronic
901229939 1:7636126-7636148 CTTCCCGGGAGCCTCCATGCTGG - Intronic
903352905 1:22728878-22728900 GCCACTGGGAGCTGTCATGCAGG - Intronic
903856701 1:26342136-26342158 CCCCCCAGGAGCCAGCATGCAGG - Intronic
904587699 1:31589051-31589073 GGCCCCGGGACCCGCCCCGCCGG + Intergenic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
917869416 1:179229030-179229052 GCCCCCGGGATCTGCCAGCCAGG + Intronic
919610610 1:199741440-199741462 GCCCCTGGGAGGAGCCATGTGGG - Intergenic
920013778 1:202889008-202889030 GCACCCGGGAGCCGCAACGCTGG + Exonic
920499302 1:206476420-206476442 GCCCCCCAGAGCCCCCATGAGGG + Intronic
920851278 1:209629749-209629771 GCGCCCGGGAGCTTCCATTCAGG - Exonic
922734417 1:227971693-227971715 GCCCCGGGAGGCCGCCATGGGGG - Intergenic
922734706 1:227972825-227972847 GCCCCGGGAGGCCGCCATGGGGG - Intergenic
924286558 1:242493646-242493668 GCCCCAGGGAGCTGCCAGGATGG + Intronic
1062920531 10:1275401-1275423 GCTGCCTGGAGCCGCCCTGCAGG - Intronic
1062925379 10:1312352-1312374 GCCCCCGGCAGGCCCCAGGCTGG + Intronic
1063960332 10:11301324-11301346 GCCCACTGGAGCCCCTATGCGGG + Intronic
1066200980 10:33142414-33142436 GCCCCTGGGAGCAGCCTAGCCGG - Intergenic
1066460349 10:35607851-35607873 ACCCCCGGGAGCCGGCCTCCGGG + Exonic
1067437118 10:46286327-46286349 GCACCCTGAAGCTGCCATGCTGG + Intronic
1070948050 10:80409035-80409057 GGGCCCGGGGGCCGCCCTGCTGG + Intronic
1072654381 10:97319906-97319928 GCCTCCGGGAGCTGGCAAGCAGG + Exonic
1075334272 10:121597582-121597604 GACCCCGGGAACCGGCCTGCGGG + Intronic
1075657856 10:124173852-124173874 GCCCCCTGGAGCCTCCCTCCAGG + Intergenic
1077373542 11:2194815-2194837 GCCCCTGGGAGCAAGCATGCTGG - Intergenic
1079348828 11:19675706-19675728 GGCCCCGGGACTGGCCATGCAGG - Intronic
1081461044 11:43273272-43273294 GCCCATGGGAGCCGCCCTGTTGG - Intergenic
1081870948 11:46382225-46382247 TCCCTCGGGAGCCGCCTTCCTGG - Intronic
1083659769 11:64246667-64246689 GGCCCCGGCGGCCGCCATGGCGG - Exonic
1084516120 11:69638889-69638911 GGACCCGGGGGCCGCCAAGCAGG + Intergenic
1084605656 11:70170181-70170203 GTCCCAGGGAGCCCCCATGATGG + Intronic
1084677510 11:70644575-70644597 GCAGGCGGGAGCTGCCATGCGGG - Intronic
1089166839 11:116483914-116483936 GCCCCAGACAGCAGCCATGCCGG + Intergenic
1089694950 11:120211162-120211184 GCGCCCGGGAGCCGCTCCGCCGG - Exonic
1091057249 11:132430510-132430532 GCTCCCAGGAGCCGCGAGGCAGG + Intronic
1091309587 11:134563053-134563075 GCCCCTGGGAGACTCCAGGCTGG + Intergenic
1091682254 12:2535420-2535442 GCAGGCGGGAGCCACCATGCCGG - Intronic
1100565510 12:95790517-95790539 GTGCCCGGGACCCGCCAGGCCGG - Exonic
1100565536 12:95790587-95790609 GCCCCGCGGAGCGGCCCTGCGGG + Exonic
1101090484 12:101280125-101280147 GCCCCTGGGCGCCGCCATGTTGG - Exonic
1101144758 12:101830735-101830757 GCCTCAGCGAGCCGCCATTCAGG + Exonic
1102180349 12:110907754-110907776 GCCCGGGGGAGGGGCCATGCTGG + Intergenic
1103385502 12:120529124-120529146 GCTCCCGGGGGCCGCCATCTTGG + Exonic
1103947043 12:124532479-124532501 GCTCCCAGGAGCCCCCTTGCAGG - Intronic
1104489838 12:129184200-129184222 GCCACCCGCAGCAGCCATGCAGG + Intronic
1104929126 12:132329095-132329117 GCTCCTGGGAGCGGCCCTGCAGG + Intronic
1106783013 13:33078706-33078728 CAGCCCGGGATCCGCCATGCTGG + Intergenic
1112378467 13:98865818-98865840 GACCCTGGGAGGCCCCATGCAGG + Intronic
1113846378 13:113394039-113394061 GCCGCCGGGAGCCGCCGGGGTGG - Intergenic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1116950253 14:50872398-50872420 TCCCCCGGAAGCCACAATGCTGG - Intronic
1117251835 14:53946793-53946815 GCCCGCGGGAGCCGCGCGGCAGG - Intergenic
1117368218 14:55051865-55051887 GCCCGCGGGCGCGGCCAAGCGGG + Intronic
1119500930 14:75126915-75126937 GCCCGCGGCCGCCGCCATGTCGG - Exonic
1120881192 14:89416701-89416723 GACCCCGGGAGCCCCCGAGCCGG - Intronic
1121012985 14:90532935-90532957 GCCCGGGGGAGGAGCCATGCAGG + Exonic
1121312480 14:92942739-92942761 GCCCTCGGGAGCCACCAAGCAGG + Intronic
1122228222 14:100291904-100291926 ACCCCCGGGAGCCAGCCTGCAGG + Exonic
1122326097 14:100881446-100881468 GCGGCCGGCACCCGCCATGCGGG - Exonic
1122982096 14:105196563-105196585 GCCCCCGGGAGCCCCGAGCCAGG + Intergenic
1124922277 15:34038801-34038823 GCCGCCGGGAGCCGGGAGGCTGG - Exonic
1127488142 15:59438095-59438117 CCCCCCGGGAGCCGCGAACCCGG + Intronic
1128538200 15:68506277-68506299 GCCCCCTGGTGCCTCCAGGCTGG - Intergenic
1129220363 15:74128719-74128741 GTCCCCTGGACACGCCATGCCGG + Intronic
1129457150 15:75682120-75682142 TCCTCCAGGAGCCGCCAGGCTGG - Intronic
1129668788 15:77595484-77595506 GCTCTCGGGAGCAGCCAGGCCGG - Intergenic
1132314223 15:100879172-100879194 GCCCCGGGGAGACTCCAGGCCGG + Intronic
1132365309 15:101252243-101252265 GCGCCCGGGCGCCGCGGTGCGGG - Intergenic
1132684164 16:1155337-1155359 GTCCCCGGGAGCCGAGGTGCAGG + Intronic
1132959269 16:2613063-2613085 GCCCCAGGCAGCCCCCATGGGGG - Intergenic
1132968564 16:2673465-2673487 GCCCCCGCGCGACGCCAGGCAGG + Intergenic
1132972329 16:2695038-2695060 GCCCCAGGCAGCCCCCATGGGGG - Intronic
1133111485 16:3550526-3550548 GCCTCTGGGAGCTGCCAGGCAGG + Intronic
1136500200 16:30666288-30666310 GCCCCAGGGAGCTGCCCTGCTGG - Intronic
1136505553 16:30700674-30700696 GCCACCGGGACCCGCCTTCCAGG - Exonic
1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG + Intronic
1139371379 16:66471464-66471486 GCCCCTGGGAGCCGCCCCGTGGG + Intronic
1139597795 16:67968373-67968395 GCCACCCGGGGCCGCCATCCCGG - Intronic
1141479903 16:84299648-84299670 GCCCATGGCAGCCACCATGCGGG + Intronic
1141625448 16:85259000-85259022 GCCCCCAGGAGCTGCCAGGCTGG + Intergenic
1145013937 17:19384915-19384937 GCCCTGGGGAGCAGCCATCCTGG - Intronic
1145925685 17:28645081-28645103 GGCCCCGGCCCCCGCCATGCCGG + Exonic
1147141757 17:38464440-38464462 GGCCCTGGGAGCCGCTGTGCTGG + Intronic
1147970815 17:44218639-44218661 GCCCCGGGGAGGCCCCAGGCTGG + Intronic
1148081746 17:44970679-44970701 GCCCAGGGGAGGCGCCAAGCCGG - Intergenic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1152138513 17:78522242-78522264 GTCCTCGGTAGCCGCCATGGTGG - Intronic
1152438186 17:80288768-80288790 GCCTCCTGGAGCCGGCAGGCAGG - Intronic
1156449932 18:37261178-37261200 GCCCCTGGGAGCAGCCAGTCTGG - Intronic
1160996594 19:1884993-1885015 GCCCCTGGGAGCTGCCTTGGGGG + Intronic
1161026834 19:2040824-2040846 GCTCCTGGGAGCCGCCTGGCTGG + Intronic
1162370303 19:10274811-10274833 GCCCCGGGGAGGCTCCGTGCTGG + Exonic
1162944085 19:14031857-14031879 GCTCCCGAGGGACGCCATGCGGG + Exonic
1164721586 19:30436048-30436070 GCCCCAGGCAGCTTCCATGCTGG - Intronic
1165061165 19:33205876-33205898 TCCCCTGGGAGCAGCCGTGCGGG + Exonic
1165751793 19:38264726-38264748 GCCCCCGGAAGTCGCCTTTCCGG - Exonic
1166798760 19:45443611-45443633 GCCCCCGGGAGCAGGCGGGCCGG + Intronic
1168104680 19:54159528-54159550 GCCCCGGAGCGCCGCCCTGCCGG + Intronic
1168246926 19:55117190-55117212 GGCCCCGGGAGACGCCGGGCGGG + Intronic
1168567282 19:57435646-57435668 GTCCCAAGGAGCCGCCCTGCAGG + Intronic
925913152 2:8586540-8586562 GCCCCCAGGAGCTCCCAAGCAGG + Intergenic
926158480 2:10471496-10471518 CCCCACGGGGGCCGCCCTGCTGG - Intergenic
929756357 2:44768691-44768713 GCCGCCGGGAGCCTCCACCCTGG + Intronic
929760571 2:44802819-44802841 GCCCCCGAGGGCCGCCTTGCGGG + Intergenic
932489347 2:72110169-72110191 GCACCCGGGAGAGGCAATGCAGG - Intergenic
937369082 2:121285282-121285304 GCCGCGGGGAGCCGCCCTCCGGG - Intergenic
942034759 2:171999965-171999987 GCCACTGGGCGCCGCCATGTTGG - Exonic
945062844 2:205924022-205924044 GCCCTATGGAGCCCCCATGCTGG + Intergenic
946361391 2:219221098-219221120 GCCTCTGGAAGCCCCCATGCAGG + Exonic
948572657 2:238927301-238927323 GCCTCCGTGAGCCACCAGGCAGG + Intergenic
948823264 2:240560933-240560955 GCCCACGTGCGCCGCCATGGAGG + Exonic
948843725 2:240672941-240672963 GCCCCCAGGCCTCGCCATGCAGG - Intergenic
948868041 2:240785210-240785232 GACCCCAGGGGCCGCCCTGCTGG + Intronic
949031214 2:241798381-241798403 TCCCCAGGAACCCGCCATGCTGG - Intronic
1169218571 20:3807423-3807445 GGCCCCGGGCGCCATCATGCTGG + Intergenic
1172951879 20:38727484-38727506 ACCCCAGGTAGCCGCCGTGCAGG - Exonic
1174216733 20:48921731-48921753 GCCCCACGGCGCCGCCATGTTGG - Intergenic
1175836867 20:62001559-62001581 GACCCCAGGAGACGCCAGGCAGG - Intronic
1176062303 20:63177795-63177817 GCCCCCGGGAGCCGAAGAGCAGG + Intergenic
1177823573 21:26058655-26058677 ACCCCCAGGTGCCGCCATCCTGG - Intronic
1179726610 21:43344622-43344644 ACCCCCAGGAGCCCCCACGCAGG - Intergenic
1180065612 21:45410733-45410755 GCCCCCAGGAGCAGCTGTGCTGG - Intronic
1180184395 21:46132285-46132307 GCCTCCGGGCCCCGCCACGCGGG - Exonic
1180187251 21:46145848-46145870 GCCCCCGGGGGCCGCAGAGCGGG + Exonic
1180614893 22:17120664-17120686 GGCCCCGGGAGCCGCTCGGCGGG - Exonic
1180871627 22:19150050-19150072 GCCCCCGCGCGGCGCCCTGCGGG - Exonic
1180977066 22:19854376-19854398 CCCCCCAGCAACCGCCATGCAGG + Intronic
1181032845 22:20156653-20156675 GCCCCAGGAAGTGGCCATGCTGG + Intergenic
1181319142 22:21991336-21991358 GACCCCGGCAGACGCCATGCAGG + Intergenic
1183427231 22:37746399-37746421 GCCCTGGGGCGCCGCCATGACGG + Intronic
1183468119 22:37990294-37990316 AACCCCGGGAGCTGCCTTGCTGG - Intronic
1184749063 22:46473736-46473758 GCCACCAGGAGCCACCAAGCAGG - Intronic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
953173039 3:40524909-40524931 GCCCCCGGAGGCCGCCATCTCGG - Exonic
953886664 3:46717950-46717972 GCCCCTGGGGGGCGCCACGCAGG - Exonic
954144830 3:48629342-48629364 GCCCCAGGGAGCTGCCATTCCGG + Intronic
958977226 3:100682182-100682204 ACCCCCGGGAGCTGCCCTGATGG + Intronic
959484110 3:106908310-106908332 CACCCTGGGAGCCGCCATGATGG + Intergenic
961734601 3:128993641-128993663 GCTCCCGGGAGCCACCAGGCGGG + Intronic
961754882 3:129121733-129121755 CCCCCCCGGACCCGCCAAGCCGG + Exonic
963888880 3:150611733-150611755 GCCCCTGGGGGCGGCCAGGCCGG - Intronic
965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG + Intergenic
968455076 4:693528-693550 GCTCACGGGAGCCTCCACGCTGG - Intergenic
968872587 4:3249284-3249306 CCCCTCGGCCGCCGCCATGCCGG - Exonic
969707617 4:8820411-8820433 CCCCCCGGGTGCAGCCAGGCTGG - Intergenic
980595072 4:134944256-134944278 GACCCCGGCCGCCGCCATGATGG + Intergenic
980923913 4:139115368-139115390 GGCCCCGGCGGCCGCCATGGCGG - Intronic
983923468 4:173371344-173371366 GCCCCCGGGGGCGGCCGGGCCGG + Exonic
985578238 5:683599-683621 GCCCCTGGCAGGGGCCATGCTGG + Intronic
985593165 5:775739-775761 GCCCCTGGCAGGGGCCATGCTGG + Intergenic
985648009 5:1094067-1094089 GCCCCTGGGGGCCCCCAGGCCGG - Intronic
985685400 5:1279255-1279277 ACCCCCGTGAGCAGCCCTGCTGG - Intronic
990380755 5:55220548-55220570 GCCCCCGGAAGGCGCCATGCAGG + Exonic
990381947 5:55227436-55227458 TCCCCCGGGAGCCGCCAGCGCGG + Intergenic
997196915 5:131986335-131986357 GCCCCCGGGATGGGCCATGTGGG - Intronic
999287520 5:150403002-150403024 GCCCCCAGGAGCTGCCATCCTGG + Intronic
1001984232 5:176060654-176060676 GGCCCCGGGATCCGCGCTGCTGG - Intronic
1002233243 5:177783411-177783433 GGCCCCGGGATCCGCGCTGCTGG + Intronic
1002262735 5:178006370-178006392 GGCCCCGGGATCCGCGCTGCTGG - Intergenic
1003544816 6:7051123-7051145 ACTCCCGGGAGCCGCCCTGAAGG + Intergenic
1007652527 6:43432355-43432377 GACCCCGGGAGTGGCCATGAGGG - Exonic
1008932451 6:56954888-56954910 GCCCCCGGGCGCAGCCCCGCCGG + Intergenic
1012887494 6:104861677-104861699 GCCCCCAGCAGCCTCCATGGTGG + Intergenic
1013369371 6:109455998-109456020 GCCCTCGGGCGCCACCCTGCAGG - Intergenic
1013588213 6:111597997-111598019 GACCCTGGGAGCCCCCATGCTGG + Intronic
1016915625 6:149241920-149241942 GCCCCCAGGAGCAGCCTTACGGG - Intronic
1018093136 6:160362799-160362821 GCCCCCGGGAGCAGTGCTGCAGG + Intronic
1018368889 6:163149585-163149607 GACCCCGCGAGCCTCCCTGCAGG + Intronic
1019233022 6:170584564-170584586 GGCCCCGGCGGCAGCCATGCGGG + Exonic
1019484547 7:1283501-1283523 GCCCCGGGCAGCCCCCAGGCAGG - Intergenic
1019663993 7:2242235-2242257 GCCCCCGGAAGCGGCGGTGCAGG + Intronic
1026734850 7:72942927-72942949 GCCACCGGGGGCCGCCAAGCCGG + Exonic
1026785183 7:73297839-73297861 GCCACCGGGGGCCGCCAAGCCGG + Intergenic
1027654945 7:80919128-80919150 GCCCCGGCGCGCCGCCCTGCAGG + Exonic
1031562582 7:123256026-123256048 GCCCATGGGATCAGCCATGCGGG + Intergenic
1032092023 7:128915876-128915898 GCGCCTGGGAGCCCCCATTCTGG + Intergenic
1032095908 7:128938417-128938439 GCTCCCGGGAACCCCCATTCTGG - Intronic
1034228110 7:149498050-149498072 GCCCGCGGGCGCGGCCAGGCGGG - Intergenic
1034243220 7:149625018-149625040 GCCCGCGGGCGCGGCCAGGCGGG - Intergenic
1034522551 7:151632093-151632115 ACCCGCGGAAGCCGGCATGCTGG - Exonic
1034589817 7:152129365-152129387 GCGGCCGGGAGCAGCGATGCGGG + Intergenic
1035239844 7:157522343-157522365 GTCCCAGGGAGCAGCCATGGAGG + Intergenic
1035557759 8:579306-579328 GCACACGTGAGCCGGCATGCTGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1045847885 8:106658320-106658342 GCCCCCGGCGGCCGCCACCCCGG - Intronic
1049175584 8:141190578-141190600 GCCCCCAGGAGCAGCAGTGCAGG - Intronic
1049743267 8:144251033-144251055 ACCTCCGGGAGACTCCATGCTGG + Intronic
1049799125 8:144509657-144509679 GAACCTGGGTGCCGCCATGCAGG + Exonic
1053350590 9:37411122-37411144 GCCCCTGAGAGCCGCCCAGCTGG - Intergenic
1056585866 9:87926720-87926742 GCCCATGGGAGCAGCCATGGGGG + Intergenic
1056611018 9:88126223-88126245 GCCCATGGGAGCAGCCATGGGGG - Intergenic
1057921942 9:99105006-99105028 GCCGCCGCGAGCTGCCAAGCGGG - Intronic
1060280689 9:122213831-122213853 GCCGCCGGGAGACCCCAGGCGGG + Intronic
1061242609 9:129383299-129383321 GCTCCCGGGAGCCGCAGCGCAGG + Intergenic
1061262713 9:129488786-129488808 CCCCCAGGGGGCCGCGATGCGGG - Intergenic
1061367808 9:130181678-130181700 GTGCCAGGGAGCCGCCATGGAGG + Intronic
1061405563 9:130391456-130391478 GCACCAGGGAGCCGCCGTCCAGG - Intronic
1061517812 9:131099585-131099607 GCCCCAGGCAGCAGCCATGGCGG - Intronic
1061859409 9:133460338-133460360 GCCGCCGGGAGCCGGCGTCCTGG + Intronic
1189349540 X:40266550-40266572 GGCCCAGGGGGCCGCCAAGCTGG + Intergenic
1189407096 X:40735298-40735320 TCCCCCGGGAGCCGCCGTGGCGG - Exonic
1200306072 X:155027099-155027121 GCCGCGGGGAGCCGCCTTCCTGG + Intronic