ID: 1136512712

View in Genome Browser
Species Human (GRCh38)
Location 16:30748804-30748826
Sequence CGTCATCCTGAAGGAGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136512712_1136512726 14 Left 1136512712 16:30748804-30748826 CCCCCGCCTCCTTCAGGATGACG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1136512726 16:30748841-30748863 GGAGGATGAGCTGCCCGACTGGG 0: 1
1: 0
2: 0
3: 16
4: 100
1136512712_1136512725 13 Left 1136512712 16:30748804-30748826 CCCCCGCCTCCTTCAGGATGACG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1136512725 16:30748840-30748862 CGGAGGATGAGCTGCCCGACTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1136512712_1136512722 -7 Left 1136512712 16:30748804-30748826 CCCCCGCCTCCTTCAGGATGACG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1136512722 16:30748820-30748842 GATGACGCTGGACGTGGGGCCGG 0: 1
1: 0
2: 1
3: 13
4: 190
1136512712_1136512723 -4 Left 1136512712 16:30748804-30748826 CCCCCGCCTCCTTCAGGATGACG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1136512723 16:30748823-30748845 GACGCTGGACGTGGGGCCGGAGG 0: 1
1: 0
2: 2
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136512712 Original CRISPR CGTCATCCTGAAGGAGGCGG GGG (reversed) Exonic
900191436 1:1353896-1353918 CAACATCCTGAAGGAGAGGGCGG - Exonic
904091277 1:27946630-27946652 GGACATCCTGCAGGAGGTGGTGG + Intronic
905796182 1:40817978-40818000 AGTCTTCTTGCAGGAGGCGGAGG + Intronic
910358959 1:86395856-86395878 AGTCAGCCTGAGGGAGGTGGAGG + Intronic
916584600 1:166139584-166139606 AGTCTTCCTGGAGGAGGAGGTGG + Intronic
919499515 1:198318341-198318363 TGTCATTCTGAAAGAGGAGGTGG - Intronic
919791929 1:201297292-201297314 CTTCTGCCTGAAGGAGGAGGAGG - Intronic
919974734 1:202603112-202603134 CGTCATCCTGTGGGAGCTGGGGG + Exonic
924458057 1:244233954-244233976 CGTCAACCCAAAGGAGGAGGAGG + Intergenic
1064944741 10:20774722-20774744 TGTCCTCCTGAAGGTGGGGGTGG + Intergenic
1067116135 10:43436914-43436936 TGTCTTCCTGAAGAAGGCTGGGG + Intronic
1070720969 10:78756875-78756897 CATCAGCCTGGAGGAGGCTGAGG - Intergenic
1071521663 10:86335201-86335223 TGGCATCCTGGAGGAGGCAGAGG - Intronic
1071849941 10:89558469-89558491 CAGCAACCTGAAGGAGGCAGGGG + Intergenic
1072232759 10:93426804-93426826 CTTGAACCTGAAGGGGGCGGAGG + Intronic
1072783273 10:98264504-98264526 CTTCATCCTGTAGGAAGCGAGGG + Intronic
1073004900 10:100315821-100315843 TGTCAGCCTGGAGGAGGCAGGGG - Intronic
1075697457 10:124447507-124447529 CGTCAGCGGGAAGGAGGCGGCGG + Exonic
1078529591 11:12126799-12126821 CATCTGCCTGAAGGAGGCAGCGG + Intronic
1081659788 11:44880964-44880986 CGTCCTCCTGTAGCAGGCGTGGG + Intronic
1081730479 11:45368665-45368687 GGTCAGCCTGAAGGCTGCGGAGG + Intergenic
1083709003 11:64536091-64536113 TTTGGTCCTGAAGGAGGCGGTGG + Intergenic
1084327102 11:68406801-68406823 CGTCAGCCTGAAGGTAGCGTGGG + Exonic
1089937293 11:122377331-122377353 TGAAATGCTGAAGGAGGCGGGGG + Intergenic
1090190383 11:124762713-124762735 GGTCTTCCTGAAGGAGGAAGAGG + Intergenic
1090284426 11:125487168-125487190 CTTCATCCTTAATGAGGCAGAGG + Intronic
1103394559 12:120597692-120597714 TGTCCTCCTGAAGGAGGCCCAGG - Intergenic
1104276069 12:127329060-127329082 CAACATCCTGTAGGAGGAGGAGG - Intergenic
1104523085 12:129493727-129493749 GGTCATCCTGGAGGAAGCTGGGG + Intronic
1104771203 12:131366020-131366042 TGCCATCCAGAAGGAGGCGGTGG - Intergenic
1107810089 13:44192080-44192102 CTGCATCCTGGAGGAGGCGGTGG - Intergenic
1117088243 14:52223315-52223337 CGACACCCTAAAGGAGGCAGAGG - Intergenic
1119262732 14:73247148-73247170 GGTCATCCTGCAGGAGGGGCTGG + Intronic
1119356154 14:74008470-74008492 CGTGAACCTGCGGGAGGCGGAGG - Intronic
1121774605 14:96582544-96582566 CTTCATCCTGCAGGAGGTGAAGG - Intergenic
1122169688 14:99862061-99862083 TGTCAGCCTGGAGGAGGCTGAGG - Intronic
1122436391 14:101703886-101703908 GGTGATCCTGAAGAAGGAGGAGG + Intergenic
1122902728 14:104788490-104788512 CTTCATCCTGGAGGAGGCCTTGG - Intronic
1122999926 14:105287931-105287953 CCTCAGCCTGAAGGAGGCCCGGG - Intronic
1123023667 14:105413643-105413665 CCTCAGCCTGAAGGAGGCCAGGG - Exonic
1125097825 15:35874836-35874858 AGTGTTCCTGAAGGAGGGGGAGG - Intergenic
1128099823 15:64989687-64989709 CGGCCTCCTGAAGGAGGGGAAGG - Exonic
1128252348 15:66172130-66172152 CCTAGTCCTGGAGGAGGCGGAGG - Intronic
1129665306 15:77576309-77576331 CCTCATGCTGGAGGAGGAGGAGG + Intergenic
1130656636 15:85795864-85795886 GGTCACCCTGACGGAGGTGGAGG + Intergenic
1132804253 16:1768426-1768448 CGGCCTCCTGGGGGAGGCGGCGG - Intronic
1133967507 16:10542145-10542167 CCTCAGCCTAAAGGAGGAGGAGG - Intronic
1136267860 16:29131489-29131511 CCTCATCCTGGAGGACGGGGAGG + Intergenic
1136512712 16:30748804-30748826 CGTCATCCTGAAGGAGGCGGGGG - Exonic
1137521910 16:49201916-49201938 CTGCATCCTGAAGGAGGAGTAGG - Intergenic
1141431889 16:83974611-83974633 CGTCATCTGGAAGGAGGGTGGGG - Intronic
1141876632 16:86829355-86829377 AGGCTTCCTGGAGGAGGCGGTGG + Intergenic
1142071164 16:88091836-88091858 CCTCATCCTGGAGGACGGGGAGG + Intronic
1142217321 16:88836119-88836141 CCTCATCCTGTGGGAGGCGTGGG - Intronic
1143016200 17:3892511-3892533 CGTCTTCCTGCAGGAGCCGGGGG - Intronic
1143202128 17:5120470-5120492 CCTCACCCTGAAGGTGGAGGTGG - Intronic
1144872870 17:18381420-18381442 CAGCAGCCTGAAGGAGGCCGAGG + Exonic
1146658364 17:34648627-34648649 CATCATCCTGAGGTAGGAGGTGG - Intergenic
1147581426 17:41629364-41629386 CCTCACCCTGAAGGTGGAGGTGG + Intergenic
1150135805 17:62694352-62694374 CTGCAGCCTGAAGGAGGTGGCGG + Intergenic
1151748377 17:76023579-76023601 CCGCAGCCTGAAGGAGGCTGAGG - Exonic
1152891294 17:82883122-82883144 CGTCAACATGAAGGACGCCGGGG - Intronic
1153355429 18:4129451-4129473 CTTCATCATGAAGGAGAGGGTGG + Intronic
1158385948 18:56991487-56991509 AGTAATCCTGAAGGAGGCAAGGG + Intronic
1161016672 19:1986874-1986896 CGTCATGTTCAAGGAGCCGGTGG - Exonic
1162854842 19:13460325-13460347 AGTCATCCAGAAAGAGGTGGGGG + Intronic
1163767217 19:19170352-19170374 CGTCACCCTGGAGGCGGCGATGG + Intronic
1165433334 19:35784429-35784451 CGGGATCCTCAAGGAGCCGGAGG - Intronic
1165480801 19:36062891-36062913 CGTCAGCCTGAAAGAGACTGAGG - Intronic
1165922696 19:39308536-39308558 GATCATCCTGTAGGAGGGGGCGG + Exonic
1168095981 19:54115077-54115099 GGTCATCCTGAGGGAGGAGAAGG - Intronic
932320034 2:70815247-70815269 CTTCATCCTGAAGGATGAGTAGG - Intronic
934640450 2:96024430-96024452 CGTCTTCCTGAGCGAGGCTGTGG - Exonic
935111531 2:100098900-100098922 CATCAGCCTGGAGGAGGCAGGGG - Intronic
936123437 2:109766264-109766286 CATCAGCCTGGAGGAGGCAGGGG + Intergenic
936221248 2:110605200-110605222 CATCAGCCTGGAGGAGGCAGGGG - Intergenic
936778176 2:115999230-115999252 CGTCATCCTGAATTAGGGTGGGG - Intergenic
938944525 2:136199616-136199638 CCTCATCCGGGAGGAGGGGGAGG + Intergenic
942971290 2:181961319-181961341 CATCATCATCAAGCAGGCGGTGG + Intronic
946688658 2:222295047-222295069 CGGCAGCCTGGGGGAGGCGGAGG - Intronic
946983535 2:225246417-225246439 CTTCATCCTGAAGAAGGCCCTGG + Intergenic
947331211 2:229031472-229031494 CTTGAACCTGAAGGAGGCGGAGG + Intronic
948507125 2:238435807-238435829 CCTCATCCGGAAGGGGGCCGAGG + Exonic
948597988 2:239092670-239092692 CGTGGTCCTGAAGCAGGCGAAGG - Intronic
1169360860 20:4947819-4947841 AGTCATTCTGAAGGAAGCTGAGG + Intronic
1170262768 20:14429823-14429845 GGTTCTCCTGAAGGAGGCTGGGG - Intronic
1170460203 20:16570738-16570760 GAGCATCCTGAAGGAGGTGGTGG - Intronic
1172880216 20:38194998-38195020 AGTCACCCTGAAGGAGGCTTGGG + Intergenic
1173503346 20:43568934-43568956 GGTCTTCCTGAGGGAGGCAGCGG + Intronic
1174347852 20:49944317-49944339 TGTAATCCTGAGGGAGGCTGAGG - Intronic
1176077462 20:63254796-63254818 GGTCATCCTGCAGGAGGGGGCGG - Intronic
1177178076 21:17719638-17719660 CCCCGTCCTGAAGGAGGTGGGGG - Intergenic
1180614919 22:17120729-17120751 TGTCATGCTGCAGGAGGAGGTGG + Exonic
1184257576 22:43295933-43295955 GGGGATCCTGGAGGAGGCGGAGG + Intronic
950526981 3:13529961-13529983 CTCCATCCTGAAGGTGGTGGGGG + Intergenic
954596629 3:51830594-51830616 CGTCATCCAGGAGCAGGCGACGG + Exonic
954621105 3:51996037-51996059 AGGCAGCCTGAAGGGGGCGGAGG - Intergenic
955911686 3:63864262-63864284 CGTCACCCTGGATGGGGCGGCGG - Intergenic
957144995 3:76412668-76412690 GGTCATGCTGATGGAAGCGGTGG + Intronic
959318183 3:104835840-104835862 ATTCCTGCTGAAGGAGGCGGGGG + Intergenic
961260194 3:125595663-125595685 CGGGTCCCTGAAGGAGGCGGAGG + Intergenic
963089573 3:141470759-141470781 CGTCTTCCAGCAGGCGGCGGTGG + Intergenic
963899508 3:150720493-150720515 CATCATCCAGGAGGAGGGGGGGG + Intergenic
967928509 3:194672533-194672555 CGTCCTCCTGACGGAAGCAGCGG - Intergenic
968540751 4:1167207-1167229 CTTTATCCTGCAGGAGGAGGAGG + Exonic
968658292 4:1787937-1787959 GGGCATCCTGAAGAGGGCGGAGG + Intergenic
978782345 4:112568930-112568952 CCTCATCATTCAGGAGGCGGAGG + Intronic
985780595 5:1868907-1868929 CGTGACCCGGAAGGAGGCAGTGG - Intergenic
986264637 5:6181343-6181365 CTCCATCCTGAAGGAGGTGCAGG + Intergenic
990308719 5:54518230-54518252 CGGCGGCTTGAAGGAGGCGGGGG - Exonic
990322926 5:54647637-54647659 CATCATCCTGAAGGCTGTGGGGG + Intergenic
992529174 5:77638848-77638870 CGCCCGCCTGAAGGAGGCGGCGG + Exonic
993724339 5:91351070-91351092 AGTCATCCTAAAGGAGCCTGAGG - Intergenic
994072723 5:95620425-95620447 GGTCATCCTGGTGGTGGCGGTGG + Exonic
995063460 5:107836097-107836119 CGTCTTCTTGAAGCAGGCAGTGG + Intergenic
999652323 5:153779642-153779664 CGTGAACCTCCAGGAGGCGGAGG - Intronic
1001330626 5:170759966-170759988 GGTCATCCTGGTGGAGGCTGGGG + Intergenic
1003022000 6:2517839-2517861 CCTCTTCCTGCAGGAGGCGGGGG - Intergenic
1003791477 6:9551933-9551955 CGTCCTCCAGAAGGTGGTGGAGG - Intergenic
1006189229 6:32197379-32197401 CTCCAGCCTCAAGGAGGCGGCGG + Exonic
1008648981 6:53544663-53544685 CGTCAGCCCGGAGGAGGAGGAGG - Exonic
1010645776 6:78386499-78386521 CGTCATCCTGATGCAGGGGGTGG + Intergenic
1011013177 6:82724831-82724853 GGACAACCTCAAGGAGGCGGGGG + Intergenic
1019143250 6:169961455-169961477 AGTCATCCTGAAGAAGGGGCTGG - Intergenic
1021225588 7:18022103-18022125 CTTGATCCTGAAGGAGATGGAGG + Intergenic
1024206758 7:47169412-47169434 CCACATCCTGAAGGAGGTGAGGG + Intergenic
1029098288 7:98106761-98106783 CATCATCCTGAAGGAGTGAGCGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1032974636 7:137208549-137208571 TGTAATCCTGAAGGACGTGGTGG - Intergenic
1035079149 7:156201890-156201912 CATCATCCTGCAGCAGGCAGTGG - Intergenic
1035234398 7:157487235-157487257 CCTCATCCTAAAGGAGGTGCTGG - Intergenic
1038707462 8:29908095-29908117 AATCATCCTGAAGGAGGTGGGGG + Intergenic
1039310965 8:36317338-36317360 CGTCCTCCTGATGGTGGGGGTGG + Intergenic
1039476629 8:37842277-37842299 CGTCACCCTGATGGGCGCGGAGG + Exonic
1040984852 8:53282239-53282261 TGTCATCCAGAAGGAGAAGGAGG - Intergenic
1041659992 8:60392076-60392098 CAACATCCAGAAGGAGGCGAGGG - Intergenic
1049247353 8:141569871-141569893 CCCCATCCTGCAGGAGGCTGAGG + Intergenic
1049681705 8:143921621-143921643 CCTCATCCTGCTGGAGGCGCAGG - Exonic
1053135320 9:35647087-35647109 CTTTACCCTGGAGGAGGCGGGGG - Intergenic
1055149771 9:72982527-72982549 CATCATCATGAAGCAGGTGGGGG - Intronic
1062451923 9:136619368-136619390 GGACTTCCTGAAGGAGGAGGAGG + Intergenic
1203364289 Un_KI270442v1:243674-243696 CGTCCCACTGAAGAAGGCGGTGG - Intergenic
1187869233 X:23750719-23750741 CTTCATCATGAAGGAGGTGTGGG - Intronic
1196245329 X:113392438-113392460 CCTTATCCTGAAAGAGGCAGTGG + Intergenic
1200239830 X:154487611-154487633 AGTCAGCTTGAAGGCGGCGGAGG + Exonic