ID: 1136515551

View in Genome Browser
Species Human (GRCh38)
Location 16:30766144-30766166
Sequence CAAACTAAGGAGTGGGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136515551_1136515557 10 Left 1136515551 16:30766144-30766166 CCTGCCTCCCACTCCTTAGTTTG 0: 1
1: 0
2: 1
3: 14
4: 255
Right 1136515557 16:30766177-30766199 TGCAGAGTTAGAGGAAAACCAGG 0: 1
1: 0
2: 0
3: 24
4: 258
1136515551_1136515558 16 Left 1136515551 16:30766144-30766166 CCTGCCTCCCACTCCTTAGTTTG 0: 1
1: 0
2: 1
3: 14
4: 255
Right 1136515558 16:30766183-30766205 GTTAGAGGAAAACCAGGAACTGG 0: 1
1: 0
2: 1
3: 21
4: 234
1136515551_1136515556 1 Left 1136515551 16:30766144-30766166 CCTGCCTCCCACTCCTTAGTTTG 0: 1
1: 0
2: 1
3: 14
4: 255
Right 1136515556 16:30766168-30766190 GATGCTGAATGCAGAGTTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136515551 Original CRISPR CAAACTAAGGAGTGGGAGGC AGG (reversed) Exonic
901140571 1:7026605-7026627 GAAACTAAGGGCTGGGAGGATGG + Intronic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
902395331 1:16129378-16129400 CAGCCTCTGGAGTGGGAGGCGGG + Intronic
902650235 1:17832638-17832660 AACCCTAAGGAGTGGGAGTCAGG - Intergenic
903019458 1:20383836-20383858 CTAAATTAGGAGTGGGAGCCAGG + Intergenic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904929208 1:34073006-34073028 CAGGCTTTGGAGTGGGAGGCTGG - Intronic
905281997 1:36855217-36855239 CAAAGCAAGGACTGGGAGCCAGG - Intronic
908061962 1:60359964-60359986 CAAAGTGGGGAGTGGGAGCCAGG + Intergenic
908556287 1:65259783-65259805 CAAACTGAGGGGTGGGAGGATGG + Intronic
908787897 1:67753501-67753523 TAAAGTAAGGAGTGGTGGGCAGG + Intronic
909465016 1:75963862-75963884 CACACCAGGGAGTGGGAAGCTGG - Intergenic
911073986 1:93855318-93855340 CAAACAAAGGAGTGAGAAGTGGG + Intergenic
912602117 1:110946769-110946791 CTAACTAAGGAGGCTGAGGCAGG - Intergenic
913413976 1:118584378-118584400 GAAATTAAGGAGTGGGAGTGGGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
916810306 1:168299718-168299740 GCAACTAAGGAGGCGGAGGCAGG - Intronic
921018873 1:211217830-211217852 CAAAATAAGGATGGAGAGGCAGG + Intergenic
921835266 1:219771979-219772001 CAAAAAGAGGATTGGGAGGCCGG - Intronic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1063347729 10:5326951-5326973 CCAACTCAGGAGTCAGAGGCAGG - Intergenic
1065887862 10:30094730-30094752 CTAAGTTAGGAGTGGGCGGCTGG - Intronic
1066617285 10:37308132-37308154 CAAGCTAGGAATTGGGAGGCTGG - Intronic
1067606283 10:47666202-47666224 CCAACAAAAAAGTGGGAGGCGGG - Intergenic
1070805090 10:79266215-79266237 AAGTCTTAGGAGTGGGAGGCAGG + Intronic
1071302323 10:84265280-84265302 CAAACTATGGGGTGTGGGGCAGG + Intergenic
1071621842 10:87127555-87127577 CCAACAAAAAAGTGGGAGGCGGG - Intronic
1072761472 10:98060496-98060518 CACTCCAAAGAGTGGGAGGCGGG - Intergenic
1073486701 10:103823786-103823808 GAGCCTAGGGAGTGGGAGGCAGG + Intronic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075875921 10:125805438-125805460 CAAGCTATGAAGTGGCAGGCTGG - Intronic
1076928752 10:133512497-133512519 CAAACTATGGAGTGTTAGACAGG + Intergenic
1077232236 11:1463014-1463036 CCAAGTAAGGAGTGGGAAGAAGG - Intergenic
1077332256 11:1988848-1988870 GGAGCTAAGGAATGGGAGGCAGG + Intergenic
1078287765 11:9975145-9975167 AATACCTAGGAGTGGGAGGCTGG - Intronic
1083252966 11:61480281-61480303 TGAACTTAGGAGTTGGAGGCTGG + Intronic
1083615929 11:64026493-64026515 CACACTTAGGAGTGGGCTGCTGG + Intronic
1085425609 11:76402076-76402098 CACACTAAGGAGTAGGAGATAGG - Intronic
1086511448 11:87562391-87562413 GCTACTTAGGAGTGGGAGGCAGG + Intergenic
1087465506 11:98499472-98499494 AAAACTAAGGGGTGAGAGGAGGG - Intergenic
1088823632 11:113475907-113475929 CAAACTGAGGTGTGTGAGGCAGG + Intergenic
1202815239 11_KI270721v1_random:44024-44046 GGAGCTAAGGAATGGGAGGCAGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092525970 12:9310629-9310651 CAGCCTAAGGTGTGAGAGGCGGG - Intergenic
1096779650 12:53984644-53984666 CAAGGTAAGAAGTGGGAGTCGGG + Intergenic
1097873949 12:64626009-64626031 CAACCAAAGGAGGGGGAGGTTGG - Intronic
1099107427 12:78514161-78514183 CAGACTCAGGAGTCTGAGGCAGG + Intergenic
1101856531 12:108448161-108448183 AAGAGCAAGGAGTGGGAGGCAGG - Intergenic
1102185297 12:110942967-110942989 CAAAATAAAGAGTTGGGGGCAGG + Intergenic
1104185023 12:126422323-126422345 TAGACTACAGAGTGGGAGGCAGG + Intergenic
1104253411 12:127118029-127118051 CAAACAAGGCAGTGGGATGCAGG - Intergenic
1108707472 13:53002668-53002690 CAAAGAAAGCAGTGGCAGGCAGG - Intergenic
1109075214 13:57825033-57825055 GATACTCAGGAGTGTGAGGCAGG + Intergenic
1109383515 13:61597409-61597431 CAAAGTTAGGAGTGGAAGTCAGG + Intergenic
1116692090 14:48121167-48121189 AAAACTAAGGAAGAGGAGGCAGG - Intergenic
1117516968 14:56511574-56511596 TAGACTAAGGAGTGGTAGGGAGG + Intronic
1118513982 14:66507493-66507515 GAAACTGAGGAGTCTGAGGCAGG - Exonic
1118793366 14:69116386-69116408 CAAAGGAAGGAGTGGGACTCTGG - Exonic
1119664068 14:76471945-76471967 CAGACTAAGAAATGGAAGGCAGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1123035520 14:105470280-105470302 CAAACTGAGGGGCGGGCGGCGGG - Exonic
1123105904 14:105840920-105840942 CAACCTCTGGGGTGGGAGGCTGG + Intergenic
1124272169 15:28292567-28292589 GCAACTCAGGAGTGTGAGGCAGG + Intronic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1128134283 15:65251179-65251201 CAAAATAAGAGATGGGAGGCAGG - Intronic
1128325304 15:66720205-66720227 CATACTAAGGTGTGAGTGGCTGG + Intronic
1128338417 15:66803153-66803175 CAAACTCAGGATGGGGAGGCAGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129597130 15:76973928-76973950 CACAGTAAGTAGTGGGAGGATGG + Intergenic
1129741607 15:77992269-77992291 CCACCTGAGAAGTGGGAGGCTGG + Intronic
1129844042 15:78760111-78760133 CCACCTGAGAAGTGGGAGGCTGG - Intronic
1132309639 15:100848242-100848264 AGACCTAAGGAGGGGGAGGCTGG + Intergenic
1133686163 16:8167389-8167411 CAACCTAATTAGTGGCAGGCAGG - Intergenic
1133749148 16:8711358-8711380 CAAAGTAAGGAGGGAGAGGGTGG + Intronic
1133970314 16:10563068-10563090 TAAACTAATGGGTGTGAGGCTGG - Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1137457307 16:48627735-48627757 GCAACTAAGGAGTCTGAGGCAGG - Intergenic
1138596438 16:58031586-58031608 CAAGTTAAGGAGTGTGGGGCAGG + Intronic
1138788424 16:59873079-59873101 CAGACCAAGAATTGGGAGGCCGG - Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1141076371 16:81009436-81009458 AAAACCAAGGAGAGGGAAGCAGG + Intronic
1141381868 16:83584215-83584237 CAAACTAAGGAGGCTGAGGCAGG + Intronic
1141828155 16:86495146-86495168 CACACCCAGGGGTGGGAGGCCGG - Intergenic
1143111012 17:4552823-4552845 AAAAATAAGGGGTGGGGGGCAGG - Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1144370409 17:14584816-14584838 GGAAGAAAGGAGTGGGAGGCAGG + Intergenic
1145251359 17:21298537-21298559 CAATGGAAGGAGTGAGAGGCAGG + Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147159137 17:38560481-38560503 CAATCTTAGGAATGGGGGGCTGG - Intronic
1147257459 17:39190505-39190527 TGAACTAAGGAGGCGGAGGCTGG - Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148760322 17:49996612-49996634 CAAAATGGGGTGTGGGAGGCAGG - Intergenic
1148892642 17:50819287-50819309 CAAAGTAACGTGTGGGAGGCTGG + Intergenic
1150282085 17:63934639-63934661 CAAAATAAGGAATGGGGGCCAGG + Intergenic
1150659014 17:67059432-67059454 CAAACCAAAGGGTTGGAGGCTGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151563965 17:74886847-74886869 CAAACTAAGGAGCAGGAAGGTGG - Intronic
1154353518 18:13607130-13607152 CAAAACAATGAGTGGGTGGCCGG + Intronic
1155370663 18:25097023-25097045 CAAAGTAAAGGGTGGGAGGTTGG - Intronic
1155377589 18:25177322-25177344 GAAAGGAAGGTGTGGGAGGCAGG + Intronic
1155566265 18:27138083-27138105 CAAACTAATGAGTTGCAGGCAGG - Intronic
1157869661 18:51218468-51218490 CAAACTAAAGAGTGGTGGGTAGG - Intergenic
1158154059 18:54405607-54405629 AAAATTAAGCAGGGGGAGGCAGG - Intergenic
1158690932 18:59659891-59659913 CAAACTTAGAACTGGGAGGGGGG - Intronic
1160023439 18:75199535-75199557 CAAACAAAGGAGGGGGGAGCAGG - Exonic
1160498349 18:79388200-79388222 CACACTCATGGGTGGGAGGCTGG + Intergenic
1160625908 18:80204838-80204860 CAATCTCAGGAGTCTGAGGCAGG + Intronic
1161059065 19:2205672-2205694 AAAACTAAGGTTTGAGAGGCAGG - Intronic
1162375519 19:10303052-10303074 TAAACTCAGGAGTTTGAGGCTGG - Intergenic
1163056229 19:14720427-14720449 CAAGCTAAGAAGAGGGTGGCCGG + Exonic
1163084022 19:14966022-14966044 GAAACTCAGAAGCGGGAGGCGGG + Intronic
1163146945 19:15386529-15386551 CACACTAAGCTGGGGGAGGCAGG - Intronic
1163563523 19:18035523-18035545 CAAACTCAGGAGGCTGAGGCAGG + Intergenic
1164479803 19:28602616-28602638 AAACCTGAGGAGTGGGAGGGAGG - Intergenic
1166143133 19:40816207-40816229 GACACTAAGAAATGGGAGGCAGG - Intronic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1168241625 19:55091798-55091820 CAAACTTAGGGATGTGAGGCTGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925800700 2:7597501-7597523 CAAAGTGAGCAGTGGCAGGCAGG + Intergenic
926591730 2:14747709-14747731 CAAATTAAAGAGTGGGAGTGAGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
930105915 2:47639312-47639334 AGAACTAGGGAGTGGGAGGGGGG + Intergenic
931622492 2:64224970-64224992 CAAACTAATGGGTGGGCAGCAGG - Intergenic
932238041 2:70136759-70136781 AAAAACAAGGGGTGGGAGGCAGG - Intergenic
932397889 2:71460653-71460675 CAGACTAGGAAGTTGGAGGCTGG + Intronic
933098656 2:78222624-78222646 AACACTAAAGAGTGAGAGGCGGG + Intergenic
933540448 2:83634550-83634572 AAAACAAAGGAGTGGAAGGAAGG - Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933769584 2:85734501-85734523 AAAAAAAAGGAGTGGGAGGAAGG + Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934688107 2:96336089-96336111 GGAACTGAGGAGTGTGAGGCAGG - Intronic
935883902 2:107594979-107595001 CAAAGGAAGAAGTGGCAGGCAGG + Intergenic
937067454 2:119028635-119028657 AAAACGATGGAGTGGGTGGCTGG + Intergenic
940313874 2:152307029-152307051 GATACTAAGGAGTCTGAGGCAGG + Intergenic
941692760 2:168518543-168518565 AAAATTAGGGAGTGGGAGGAAGG - Intronic
942346487 2:175007736-175007758 CAAACTAGTGAGTGGAAAGCTGG - Intergenic
943912217 2:193583723-193583745 AATACTGAGGAGTGGGAGGGAGG + Intergenic
944986001 2:205177905-205177927 CAAACTGAGGACAGGGAGACAGG - Intronic
946269473 2:218578654-218578676 TAAAAGAAGGAGCGGGAGGCGGG - Intronic
948082350 2:235216595-235216617 CCCACTGTGGAGTGGGAGGCAGG + Intergenic
948289743 2:236816320-236816342 CAAACACAGGTGTGGGCGGCCGG + Intergenic
948406871 2:237728425-237728447 CCAGTTAAGGGGTGGGAGGCAGG + Intronic
1169034744 20:2440413-2440435 CAAACATAGGCATGGGAGGCAGG + Intergenic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1173393198 20:42653518-42653540 GCAGCTAAGGAGTGGAAGGCTGG + Intronic
1173656056 20:44701043-44701065 CAAAGAAAGGAGTGAGAGGCTGG - Intergenic
1174181269 20:48676474-48676496 CCACCTACAGAGTGGGAGGCAGG + Intronic
1174702302 20:52621329-52621351 CAAGCTAAGGGGTGGCAGGTAGG + Intergenic
1175102102 20:56586597-56586619 AAAAAAAAGGAGTGGGGGGCGGG + Intergenic
1175112166 20:56656167-56656189 CGAGCTGAGGAGTGTGAGGCTGG + Intergenic
1175446154 20:59021144-59021166 CACACAGAGAAGTGGGAGGCAGG + Intronic
1175609728 20:60340495-60340517 CAAACCAAACAGTGGGAGACTGG - Intergenic
1175618410 20:60423036-60423058 AAAACAAAGAAGTGGGATGCAGG - Intergenic
1176076374 20:63250182-63250204 CAAACAAAGGTGTGGTGGGCGGG - Intronic
1177161669 21:17554480-17554502 CAAACCAAGGAGGGGGAGAGGGG + Intronic
1178863196 21:36306364-36306386 CAAACTCAGGAGGCTGAGGCTGG + Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1182364093 22:29766435-29766457 CAATCTACGGAGTGGGCGGGTGG - Intronic
1182833761 22:33324750-33324772 CAAACTAAGGAGTGAGATTATGG + Intronic
1183310257 22:37105747-37105769 CGAACCCAGGAGTTGGAGGCTGG - Intronic
1184793681 22:46718392-46718414 CAAACAGAGGAGGGGAAGGCGGG + Intronic
1185394366 22:50579156-50579178 AAATCCAAGGAGTGGGAGGGTGG + Exonic
949510769 3:4764927-4764949 AAAAATAAGTAGTGGGTGGCTGG + Intronic
950787020 3:15445333-15445355 CAAAATAAGGAATGGTTGGCCGG - Intronic
953069447 3:39504763-39504785 GAATCAAAGGAGTGGGAGGCAGG + Intronic
953391955 3:42539138-42539160 CCAAGTAGGGAGTGGGAGGAGGG - Intergenic
954735995 3:52706739-52706761 CAAACTGAGGGTTGGGAGGGAGG - Intronic
958064143 3:88521168-88521190 CATACCCAGGAGTGGGATGCTGG + Intergenic
960368293 3:116802196-116802218 CAAACTATGGCGTGGGAAGCAGG + Intronic
960383492 3:116992458-116992480 CAAAATTAGGAGTGGGACTCTGG + Intronic
960608357 3:119531523-119531545 CAAACCATTGAGTCGGAGGCAGG + Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
962992631 3:140592955-140592977 AAAACTAAGGAGTGTGGGGTGGG - Intergenic
963880449 3:150522651-150522673 CAAACTTTGGAGTAGGAGTCAGG - Intergenic
964387471 3:156163955-156163977 CCAACTGAGGAGTTGGATGCTGG + Intronic
968139685 3:196245700-196245722 CAAAGTAAAGAATAGGAGGCCGG + Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
969134415 4:5018972-5018994 AAAAAAAAGGAGTGGGAGGATGG - Intronic
969601593 4:8179648-8179670 CTCACTAAGGGGTGGGGGGCGGG + Intergenic
970219364 4:13794974-13794996 AAAAATCAGAAGTGGGAGGCAGG - Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970771742 4:19621472-19621494 AAAACTGAAGAGTGGGAGGGGGG + Intergenic
971477299 4:27084380-27084402 AAAATTAAGGAGTTGAAGGCTGG - Intergenic
971771028 4:30897198-30897220 TAAACAAAGAACTGGGAGGCCGG - Intronic
972718717 4:41674988-41675010 GAAACTCAGGAGTGGCAAGCAGG + Intronic
973207043 4:47572334-47572356 CTAGCTGAGGAGTGGGAGACAGG + Intronic
976253048 4:83072851-83072873 AAAAAAAAGGAGTGGGAAGCAGG - Intronic
979385984 4:120066415-120066437 GAAAGTAAGGGGTGGGAGGTGGG + Intronic
979730150 4:124014132-124014154 CAAACTGAGAAGTGGCAGCCTGG - Intergenic
981123915 4:141083939-141083961 CAGACATAGGATTGGGAGGCAGG - Intronic
982660408 4:158200099-158200121 CAAACCAAGGTGTCGGAGGTGGG + Intergenic
984918087 4:184741290-184741312 CACACTCAGGAGTGGCCGGCTGG + Intergenic
986312751 5:6566729-6566751 CAAACTAAGGCTTGGGAAGATGG - Intergenic
987257296 5:16169206-16169228 CAAACAAAGGAGTGCCAGGAGGG + Intronic
989720771 5:44525552-44525574 GATACTATGGATTGGGAGGCAGG - Intergenic
991649281 5:68835308-68835330 CAAAATAAGGAGGGGGCGACGGG + Intergenic
992052283 5:72952321-72952343 CAAACTAAGGAATGGAAAGGGGG + Intergenic
993728276 5:91393064-91393086 CAAACTAAGGGAGGGGAGGATGG - Intergenic
993920751 5:93798176-93798198 CACAATAAGGAGTGGCAGGTTGG - Intronic
994175507 5:96706663-96706685 CAAGCCAATGACTGGGAGGCTGG - Intronic
996379751 5:122850906-122850928 GAAACCAAGGAGTGTGAGGCTGG + Intronic
996542175 5:124641954-124641976 CAAACTATGGTTTGGGAGGATGG - Intronic
997832196 5:137159491-137159513 GAGACTCAGAAGTGGGAGGCTGG - Intronic
1000028961 5:157385157-157385179 CAGACTTCGGAGTGAGAGGCGGG - Intronic
1000195035 5:158948859-158948881 TAAACTGAGGGGCGGGAGGCAGG - Intronic
1001954679 5:175840990-175841012 CCAACTGTGGTGTGGGAGGCTGG - Intronic
1002692691 5:181061350-181061372 CAAACTAAGAGTTGGGTGGCGGG + Exonic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1005864116 6:29926001-29926023 ATAGGTAAGGAGTGGGAGGCAGG + Intergenic
1006053002 6:31357595-31357617 AGAGGTAAGGAGTGGGAGGCAGG - Intergenic
1006301737 6:33197187-33197209 GCAACAAAGGAGTGGCAGGCAGG - Intronic
1006312770 6:33272488-33272510 AAACCTAAGGAATGGGGGGCGGG + Intronic
1007181633 6:39933229-39933251 TAAACTAGGGGGTGGGGGGCTGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008600615 6:53090470-53090492 CAAATTAAGCAGTGGGAGTGGGG - Intronic
1009719481 6:67448638-67448660 CCAACTAAGGAGTGAAAGTCCGG - Intergenic
1011182145 6:84633075-84633097 CAACCTAGGGTGTGAGAGGCAGG + Intergenic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1014543393 6:122702439-122702461 GACACTAAGGAGCGTGAGGCAGG - Intronic
1015269196 6:131322292-131322314 AAAGCTACGCAGTGGGAGGCAGG - Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1024709527 7:51999694-51999716 CAAACTCAGGAGGCTGAGGCAGG - Intergenic
1026227160 7:68452626-68452648 CACACTAAGGAGTGGAAGGCTGG + Intergenic
1026781751 7:73272771-73272793 GAGACTCAGGGGTGGGAGGCAGG - Intergenic
1027022600 7:74826205-74826227 GAGACTCAGGGGTGGGAGGCAGG - Intronic
1027065412 7:75119704-75119726 GAGACTCAGGGGTGGGAGGCAGG + Intronic
1027459721 7:78437048-78437070 CAGACTGAGGTGTGGGAGCCTGG + Intronic
1028802953 7:94988826-94988848 TAAATTATGGGGTGGGAGGCAGG - Intronic
1033095440 7:138426426-138426448 TAAAGTAAGGAGTGAGAAGCAGG + Intergenic
1033822338 7:145149403-145149425 AAAACAAAGGAGTGGGAAACTGG - Intergenic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1038184696 8:25262928-25262950 AAAACTCAGGAGGTGGAGGCAGG - Intronic
1038571539 8:28666916-28666938 CAAACCAGGGAGTCGAAGGCAGG - Intronic
1040836607 8:51738013-51738035 CAAACAAAGGACTGTGATGCTGG + Intronic
1041499365 8:58523180-58523202 CAAACTTAGGAGAGGGATGTGGG - Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042230641 8:66550964-66550986 CAAATTAAGGGTTGGGAGGTGGG - Intergenic
1044565506 8:93657878-93657900 CAATCTTTGGAGTAGGAGGCAGG + Intergenic
1047682466 8:127268215-127268237 CAAACTAAGGTGTGAAAGACTGG - Intergenic
1048189835 8:132277909-132277931 GAAGCTAAGGAGAGGGAGGTAGG - Intronic
1049414001 8:142487229-142487251 CAGGCGAAGGGGTGGGAGGCTGG - Intronic
1049754902 8:144306575-144306597 CAAGCTCAGGAGTTGGAGACTGG - Intronic
1053080083 9:35168390-35168412 CCATCTATGGAGTGGGAGGAGGG - Intronic
1053164471 9:35834957-35834979 CAGACAATGGGGTGGGAGGCAGG - Intronic
1053463295 9:38287420-38287442 CACACTAAGGAAGGTGAGGCTGG - Intergenic
1055956449 9:81778160-81778182 CAAACTCAGGAGGCCGAGGCAGG - Intergenic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1059909932 9:119031832-119031854 CAAACTCAGAATAGGGAGGCAGG + Intergenic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061212852 9:129203562-129203584 CAAAAGAAGGCCTGGGAGGCTGG + Intergenic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1188511793 X:30944019-30944041 GAAAAAAAGGAGTGGGAGGAAGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1196215330 X:113044273-113044295 CAAACTCAGGAGGCTGAGGCAGG - Intergenic
1196911445 X:120488321-120488343 GAAAGGAAGGGGTGGGAGGCAGG + Intergenic
1197248171 X:124187980-124188002 CAAATTAAGGGGTTGGAGGAAGG + Intronic
1197696630 X:129556944-129556966 CCAGCTAAGGAATGGGAGGGAGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic