ID: 1136516828

View in Genome Browser
Species Human (GRCh38)
Location 16:30773481-30773503
Sequence CTGGCCAGAGACCCTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136516828_1136516832 -10 Left 1136516828 16:30773481-30773503 CCCACGGCAGGGTCTCTGGCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1136516832 16:30773494-30773516 CTCTGGCCAGTGTCGAGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 137
1136516828_1136516835 2 Left 1136516828 16:30773481-30773503 CCCACGGCAGGGTCTCTGGCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1136516835 16:30773506-30773528 TCGAGGCTGGGCCCAGTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 144
1136516828_1136516834 1 Left 1136516828 16:30773481-30773503 CCCACGGCAGGGTCTCTGGCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1136516834 16:30773505-30773527 GTCGAGGCTGGGCCCAGTTGAGG 0: 1
1: 0
2: 0
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136516828 Original CRISPR CTGGCCAGAGACCCTGCCGT GGG (reversed) Intronic
901062002 1:6475868-6475890 CTGATCTGAGACCCAGCCGTGGG + Intronic
901400687 1:9013479-9013501 CTGGCCAGAGACCCTCCAGCAGG + Intronic
901853185 1:12029023-12029045 GTGTCCAGAGACCCTGGTGTGGG - Exonic
902333993 1:15744445-15744467 CTGGCCATAGCCTTTGCCGTGGG + Exonic
902398678 1:16145710-16145732 CTGGCCAGAGAGCCTACCCCAGG + Intronic
905289476 1:36911720-36911742 CTGCCCAGAGACCCTGATGAGGG + Intronic
907751213 1:57265067-57265089 CTGGCCAGAGTCCCTTGAGTAGG + Intronic
915164142 1:153939286-153939308 CTGTGCAGGGACCCTGCCCTTGG - Intronic
916583470 1:166129156-166129178 GTGCCCAGAGCCCCTGCTGTGGG + Intronic
917471535 1:175330126-175330148 CTCGACAGAGAACCTGTCGTAGG + Exonic
919750746 1:201036476-201036498 CTGGGCAGCGACCCTGCTGCGGG + Intergenic
922618057 1:226974672-226974694 CTGGCCAGCAACCCTGACCTTGG - Intronic
1062956584 10:1544278-1544300 GTGGCCACAGCCCCTCCCGTTGG + Intronic
1063523529 10:6762016-6762038 ATTGCTAGAGACCCTGCCATCGG - Intergenic
1064179196 10:13100196-13100218 CTGACCAGGGAACCTGCCGGCGG - Exonic
1069621793 10:69841809-69841831 AAGGGCAGAGACCCTGCAGTGGG + Intronic
1069713961 10:70508903-70508925 CTGGTCTGAGCCCCTGCCCTGGG + Intronic
1071695214 10:87863208-87863230 CTGCCCAGAAACCCAGCCGGAGG - Exonic
1071970310 10:90898830-90898852 CAGGCCAAAGACCCTGACCTTGG - Intronic
1072229186 10:93399075-93399097 CTGGCCAGAGAGCTTGCCTAAGG + Intronic
1075341820 10:121652846-121652868 CTGGGTAGAGACCCAGCAGTGGG - Intergenic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1075967992 10:126629397-126629419 CTGGCCAGAGACCATCTCTTCGG + Intronic
1076804779 10:132849885-132849907 CTGGCCAGAGCCGCTGCTGCGGG + Intronic
1076874442 10:133208713-133208735 CGGCACAGAGACCCTGCGGTGGG - Intronic
1076883717 10:133251922-133251944 CTGGGCAGGGGCCCTGCTGTGGG + Intergenic
1076921384 10:133456374-133456396 CTGGGCTGCGGCCCTGCCGTGGG + Intergenic
1077552520 11:3207313-3207335 CTGGCCAGAAACCATGAAGTGGG - Intergenic
1079296398 11:19238723-19238745 CTGGTCAGAAATCCTGCTGTTGG - Intronic
1080497074 11:32830296-32830318 GTGCCCAGTGACCCTGCCGAGGG - Intronic
1081724751 11:45320543-45320565 CTGGCAAGGGGCCCTGCAGTGGG + Intergenic
1083725892 11:64627885-64627907 CTGCCCAGAGACCCGGGCCTGGG + Intronic
1084955143 11:72687210-72687232 CAGGACACAGACCCTGCCCTTGG - Intronic
1088320581 11:108550988-108551010 CTGGCCAAACACCCTGTCTTCGG + Intronic
1089396450 11:118139078-118139100 CTCGCCAGCTCCCCTGCCGTCGG + Intronic
1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG + Intronic
1092892540 12:12982157-12982179 CTAGCCAAAGGCCCTGCCCTTGG + Intronic
1096525715 12:52208993-52209015 CTGAACAGAGACCCCACCGTGGG - Intergenic
1096889060 12:54748130-54748152 CTGGGCAGATACCCAGCAGTGGG - Intergenic
1102829764 12:115987092-115987114 CAGGACAAAGACCCTACCGTAGG + Exonic
1103558782 12:121781268-121781290 CAGGCAAGTGACCCTGCCTTAGG + Exonic
1103798707 12:123523194-123523216 CGTGACAGAGACCCTGCCCTTGG - Intronic
1105704562 13:22961069-22961091 CTGGTCAGAGACCCTGTCCATGG - Intergenic
1105857515 13:24386120-24386142 CTGGTCAGAGACCCTGCCCATGG - Intergenic
1106723849 13:32464301-32464323 CTGGCAAGAGAACCTGCAGCAGG - Intronic
1107012991 13:35685994-35686016 CTCAGCAGAGACCCTGCCGCTGG - Intergenic
1113801243 13:113087489-113087511 CTGGCCACAGACCCCGACGGGGG + Intronic
1113917686 13:113884124-113884146 CTGGCCAGAGGCCCCGCCGTGGG - Intergenic
1121332202 14:93056607-93056629 CTGCACTGAGACCCAGCCGTGGG - Intronic
1121465336 14:94111960-94111982 CTGGCCAGATGCCCAGCCCTGGG + Intronic
1121731789 14:96192558-96192580 CTGGGCAGAGCCCCTCCCGGGGG + Intergenic
1122083911 14:99286237-99286259 CTGGACACAGACCCTGCCCTCGG + Intergenic
1122580535 14:102768991-102769013 CTGGCCAGAGGCCCTGAAATTGG - Intergenic
1123918629 15:25055246-25055268 CTGGCCAGGAACTCTGCTGTGGG + Intergenic
1124368865 15:29091939-29091961 CTGGCCAGAGCCCCTTCCACTGG - Intronic
1126389011 15:48125941-48125963 CTGGCTAAAGATCCTGCTGTTGG - Intronic
1127899434 15:63330122-63330144 CTGGCCAGACTCCCTGCCCCAGG + Intronic
1129664519 15:77572098-77572120 ATGGCCAGAGACCCTGTTGGTGG + Intergenic
1129727471 15:77908958-77908980 GGGGCCAGGGACCCTGCCTTCGG - Intergenic
1129790340 15:78336947-78336969 CTGGGCAGAGACCCGGCTCTTGG - Intergenic
1130052926 15:80498794-80498816 CTGGCCACAGTCCCTGCAGATGG + Intronic
1130258492 15:82336978-82337000 GGGGCCAGGGACCCTGCCTTCGG - Intergenic
1130282814 15:82532528-82532550 GGGGCCAGGGACCCTGCCTTCGG + Intergenic
1130596434 15:85252982-85253004 GGGGCCAGGGACCCTGCCTTCGG + Intergenic
1131425764 15:92344358-92344380 CTGGCCAGGGGCCCTGCACTGGG - Intergenic
1132673488 16:1112209-1112231 CTGGCCAGAGGCCTGGCAGTTGG + Intergenic
1133304967 16:4802832-4802854 CTGGCCAGGGACGCGGCCGGCGG + Exonic
1136516828 16:30773481-30773503 CTGGCCAGAGACCCTGCCGTGGG - Intronic
1136748633 16:32614035-32614057 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1138630521 16:58290939-58290961 CAGGCCAGTGCCCCTGCCTTTGG - Exonic
1141191957 16:81831573-81831595 CTGGTCAGAGACCCAGCCAGGGG - Intronic
1141604283 16:85144153-85144175 CTGGGCAGAGGCCCTGCAGGAGG + Intergenic
1141627518 16:85269039-85269061 CTGGACAGTGACCCTGGGGTGGG + Intergenic
1141761118 16:86029294-86029316 CTGGCTAGCGACCCTGCACTAGG + Intergenic
1141943769 16:87296289-87296311 CTGCCCAGAGCCCATGCTGTCGG + Intronic
1142225204 16:88873783-88873805 CTGGCCAGAGACCAGGCAGATGG - Intergenic
1203050766 16_KI270728v1_random:873249-873271 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1145266014 17:21379871-21379893 CTGGCCAAGGACCCAGCCCTGGG + Intronic
1145977355 17:28992028-28992050 CAGGCCAGATACTCTGCCCTCGG - Intronic
1146258644 17:31406400-31406422 CTGGCCAGAGGCACTGGCTTTGG + Intronic
1147806512 17:43135530-43135552 CCGGCCAGAGACCCTACACTAGG - Intergenic
1150132415 17:62676303-62676325 CAGGCCAGACGCCCTACCGTGGG - Intronic
1151674489 17:75590536-75590558 CTTGCCAGGGTCCCTGCAGTGGG + Intergenic
1151877602 17:76876102-76876124 CCGGCCTGAGTCCCTGCCTTGGG - Intronic
1151886379 17:76925426-76925448 CTGGGCTGTGACCCTGCTGTGGG + Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1153226807 18:2906337-2906359 CTGCCGAGGGACCCTGCCGGGGG - Intronic
1153611894 18:6894304-6894326 CTGTACACACACCCTGCCGTTGG - Intronic
1157520440 18:48341871-48341893 ATGGAGAGAAACCCTGCCGTTGG + Intronic
1158401666 18:57126956-57126978 GTGGCAAGAGACCCAGCTGTGGG + Intergenic
1158403427 18:57140952-57140974 CTGGCCAATGGCCCTGCAGTTGG + Intergenic
1160693081 19:469061-469083 CTGGCCAGTGAGCCTGCGTTGGG - Intronic
1160778594 19:867942-867964 CAGGCCCGCGTCCCTGCCGTCGG - Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161724594 19:5921170-5921192 CCGGCCACAGCCCCCGCCGTCGG + Intronic
1162294705 19:9805309-9805331 CTCGCCATAGATCCTGCCCTTGG - Intergenic
1162818009 19:13207782-13207804 CCGGCCAGAGGCTCGGCCGTGGG + Exonic
1163320372 19:16571485-16571507 CTGCCCAGAGTCCCTGCCCGGGG + Intronic
1164869594 19:31631917-31631939 CTGGGCAGAGCCCATGCCGAGGG + Intergenic
1166311133 19:41963235-41963257 CTGGCCACAGACACTGGCATTGG + Intergenic
1168651577 19:58095687-58095709 TTGGCCAGTGACCCAGCCGGAGG - Intronic
931497850 2:62829979-62830001 CTGGGTAGATACCCTGCAGTGGG - Intronic
932277341 2:70461464-70461486 CTGGCCACAGACCCTTCCAGTGG - Intronic
937094038 2:119224237-119224259 CTGGCCAGAGCCCCAGCCGTGGG - Intronic
937853415 2:126656101-126656123 CGGGCCAGAGCCCCTCCCCTCGG + Exonic
944526748 2:200627300-200627322 TGGGCAAGAGACCCTGCCCTAGG - Intronic
946737840 2:222772622-222772644 CTGTCCTGAGACCCTGCCTGGGG + Intergenic
947301066 2:228689141-228689163 CTCCCCAGAGACCCTGGCCTGGG + Intergenic
948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG + Intronic
1170578786 20:17682557-17682579 CTGGCCGGAGACCCCCCCCTCGG - Intergenic
1172057740 20:32166039-32166061 CTGGCTGGAAACCCTGCCTTGGG - Exonic
1172190027 20:33056350-33056372 GTGGCCACAGGCCCTGCGGTGGG + Intronic
1172198149 20:33106250-33106272 CTAGCCATTGACTCTGCCGTGGG - Intronic
1172777219 20:37414709-37414731 CTGGCTAGAGACCCCGATGTTGG - Intergenic
1173321227 20:41989134-41989156 CTGGTCAGGGTCCCTGCCTTGGG - Intergenic
1175522030 20:59608230-59608252 ATGGCCACAGACCCGGCCATGGG - Intronic
1175660578 20:60808849-60808871 CTGGGCAGAGCCCCTTGCGTGGG + Intergenic
1177725090 21:24956480-24956502 CTGGTCAGAGACCATCCCCTCGG - Intergenic
1178297083 21:31419042-31419064 CTGGCCAGTGACCCTCCTGAAGG + Intronic
1181439891 22:22930334-22930356 CTGCCCAGAGACCCAGGCCTGGG + Intergenic
1183084782 22:35480159-35480181 CTGCCCAGCGATCCTGCCGGAGG + Intergenic
1183253082 22:36744032-36744054 CAGGCCAGAGACCCTGAGGTGGG - Intergenic
1184188392 22:42879242-42879264 CTGCCCAGCGAGCCTGCAGTTGG + Intronic
949888385 3:8714068-8714090 CTGGCCTGTGACCCTGCTGGGGG + Intronic
950810761 3:15647969-15647991 CTGTCCAGAGCCCCTGCTGAGGG + Intergenic
954691132 3:52396276-52396298 CTGCCCAGGGACCCTGAGGTGGG - Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
956878584 3:73488435-73488457 CTGTGCAGAGACCCTGTGGTAGG - Intronic
960549071 3:118953398-118953420 CTGGGTAGAGACCCAGCAGTAGG + Intronic
961451384 3:127003849-127003871 CTGGACAGAGACCCAGCCCTAGG - Intronic
963337685 3:143995807-143995829 CTGTCCAGTGACCCTGTAGTAGG - Intronic
964793596 3:160475009-160475031 CTGGGCACAGCCCCTGCCTTTGG - Intronic
965869495 3:173249306-173249328 CAAGACAGAGACCCTGCAGTGGG + Intergenic
968506183 4:972478-972500 CTGGCCAGGGACGCTGAGGTGGG - Intronic
968811510 4:2801514-2801536 CCGGCCAGAGACCCCGGCCTGGG + Intronic
968873335 4:3252435-3252457 CTGCCCAGAGGCCCTGGGGTGGG - Intronic
969527766 4:7712723-7712745 GTGGCCAAAGACCCTGGGGTGGG - Exonic
985025759 4:185737624-185737646 CTGGCCTGAGACCCTGCTCACGG - Intronic
989094787 5:37771825-37771847 CAGGCCAGAGACCCTGCAAAAGG + Intergenic
995871862 5:116751826-116751848 CTGGCTAGAGACAGTGCCCTAGG - Intergenic
996395824 5:123012884-123012906 CTGGCCAGAGACCTGTCCTTGGG + Intronic
996732408 5:126728590-126728612 CTAACCAGAGACCCTTCCCTGGG - Intergenic
996848823 5:127930670-127930692 GTGGCCTGAGACCCTGCAGTGGG + Intergenic
997451307 5:133985882-133985904 CTGGTCAGAGGCCCTGCCATAGG - Intronic
997592674 5:135085602-135085624 CCAGCCAGAGACCCTGGGGTGGG - Intronic
998236537 5:140402590-140402612 CTTGCCAGAGTCCCTGCCCTTGG + Intronic
1001990509 5:176112410-176112432 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002226363 5:177725730-177725752 CTGCCCAGAGGCTCTGCCCTGGG + Intronic
1002267484 5:178045483-178045505 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1004337969 6:14781926-14781948 GCGCCCAGAGACCCTGACGTGGG + Intergenic
1005910246 6:30303152-30303174 CTGGGCACACACCCTGCAGTGGG - Intergenic
1006394599 6:33778921-33778943 CTGGCCAGAGACCATGGTGGAGG - Intronic
1010891114 6:81312203-81312225 CTGGTCACAGACCCTGCCCTGGG + Intergenic
1011101395 6:83726919-83726941 AAGGACAGAGACCCTGCCCTGGG + Intergenic
1014075058 6:117226027-117226049 CTGGCATGAGACCATGCCATTGG - Intergenic
1014093907 6:117439073-117439095 CTGGCCAGAGACTCAGCAGTTGG - Intronic
1018238199 6:161746309-161746331 CTTCCCAGAGACCCAGCTGTGGG + Intronic
1019468557 7:1204518-1204540 CTGGCCAGAGACCCAGGGGAGGG + Intergenic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1019605961 7:1910361-1910383 CTGGCCAGAGACCGTGGAGCTGG - Intronic
1025036356 7:55594674-55594696 CTGGCCAGGCTCCCTGCAGTTGG - Intergenic
1029605712 7:101598414-101598436 CTGGCCAGAGGCCCTGCCAGAGG - Intergenic
1029651431 7:101895410-101895432 CTGGCCTGGGACCCTGGCATGGG + Intronic
1030972763 7:116080827-116080849 CTGGCCAGATACCTAGCAGTAGG - Intronic
1031012453 7:116538003-116538025 TTGGCCAGAGACCCTGGGGTGGG + Intronic
1031542228 7:123008271-123008293 CTGGTCAGATTCCCTGCTGTTGG + Intergenic
1032482584 7:132258540-132258562 CTGACCATAGCCCCTGCCTTTGG + Intronic
1034542005 7:151764354-151764376 CTGTCCAGAGACCCAGAGGTTGG + Intronic
1034958183 7:155348956-155348978 CTGGCCAGAGGTCCTGGCATGGG - Intergenic
1037745104 8:21637019-21637041 CTGGCACAAGACCCTGCCCTGGG - Intergenic
1038217810 8:25578626-25578648 CTGGCCTCAGACCCTTCCTTTGG - Intergenic
1038482718 8:27912814-27912836 CTGCCCAAAGACCCTGATGTAGG + Intronic
1043296285 8:78666692-78666714 CTGGCCAGTGACACTTCCTTAGG - Intronic
1047977909 8:130149794-130149816 CTGGCTAGAGACCTTTCTGTGGG + Intronic
1049779550 8:144422567-144422589 CTGGCCAGGGGCACTGCCATGGG - Intergenic
1052999859 9:34571971-34571993 GTGGGCAGAGACCCTGCCAGGGG - Intronic
1055305349 9:74923650-74923672 GTGACAAGAGACCCTGCCGAAGG + Intergenic
1057899737 9:98939148-98939170 GTGGCCAGAGACCCTGGAGACGG + Intergenic
1059711053 9:116868065-116868087 CTGGACTGAGACACTGCCCTGGG + Intronic
1060756838 9:126219807-126219829 CTGGCCTGGGGCCCTGCCTTGGG + Intergenic
1060781563 9:126416863-126416885 CTCGCCAGAGACCCAGCTGATGG + Intronic
1061774000 9:132948607-132948629 CTGGCCAGGTGCCCTGCCGTTGG + Intronic
1062373800 9:136253124-136253146 CTGCCCAGGGACCCTGCCGCAGG + Intergenic
1062724216 9:138062218-138062240 CTGACCAGATACCCTGCCCAGGG + Intronic