ID: 1136521070

View in Genome Browser
Species Human (GRCh38)
Location 16:30796180-30796202
Sequence TGCTGCAGTGAGTGTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136521070_1136521072 10 Left 1136521070 16:30796180-30796202 CCAAGATCACACTCACTGCAGCA No data
Right 1136521072 16:30796213-30796235 TCGCCCAAGCTGGATTGCAGTGG 0: 11
1: 1738
2: 74826
3: 237505
4: 248929
1136521070_1136521075 21 Left 1136521070 16:30796180-30796202 CCAAGATCACACTCACTGCAGCA No data
Right 1136521075 16:30796224-30796246 GGATTGCAGTGGCGCGATCTCGG 0: 74
1: 23033
2: 95950
3: 158415
4: 135646
1136521070_1136521071 0 Left 1136521070 16:30796180-30796202 CCAAGATCACACTCACTGCAGCA No data
Right 1136521071 16:30796203-30796225 CACTAGAGAGTCGCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136521070 Original CRISPR TGCTGCAGTGAGTGTGATCT TGG (reversed) Intergenic
No off target data available for this crispr