ID: 1136521071

View in Genome Browser
Species Human (GRCh38)
Location 16:30796203-30796225
Sequence CACTAGAGAGTCGCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136521069_1136521071 25 Left 1136521069 16:30796155-30796177 CCTGGGAGACACAGGTTGCAGTT No data
Right 1136521071 16:30796203-30796225 CACTAGAGAGTCGCCCAAGCTGG No data
1136521070_1136521071 0 Left 1136521070 16:30796180-30796202 CCAAGATCACACTCACTGCAGCA No data
Right 1136521071 16:30796203-30796225 CACTAGAGAGTCGCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136521071 Original CRISPR CACTAGAGAGTCGCCCAAGC TGG Intergenic
No off target data available for this crispr