ID: 1136521072

View in Genome Browser
Species Human (GRCh38)
Location 16:30796213-30796235
Sequence TCGCCCAAGCTGGATTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563009
Summary {0: 11, 1: 1738, 2: 74826, 3: 237505, 4: 248929}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136521070_1136521072 10 Left 1136521070 16:30796180-30796202 CCAAGATCACACTCACTGCAGCA No data
Right 1136521072 16:30796213-30796235 TCGCCCAAGCTGGATTGCAGTGG 0: 11
1: 1738
2: 74826
3: 237505
4: 248929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136521072 Original CRISPR TCGCCCAAGCTGGATTGCAG TGG Intergenic
Too many off-targets to display for this crispr