ID: 1136521075

View in Genome Browser
Species Human (GRCh38)
Location 16:30796224-30796246
Sequence GGATTGCAGTGGCGCGATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413118
Summary {0: 74, 1: 23033, 2: 95950, 3: 158415, 4: 135646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136521070_1136521075 21 Left 1136521070 16:30796180-30796202 CCAAGATCACACTCACTGCAGCA No data
Right 1136521075 16:30796224-30796246 GGATTGCAGTGGCGCGATCTCGG 0: 74
1: 23033
2: 95950
3: 158415
4: 135646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136521075 Original CRISPR GGATTGCAGTGGCGCGATCT CGG Intergenic
Too many off-targets to display for this crispr