ID: 1136522510

View in Genome Browser
Species Human (GRCh38)
Location 16:30805974-30805996
Sequence GGTCCTTCCCCCAGGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136522510_1136522523 21 Left 1136522510 16:30805974-30805996 CCGAGCTCCCTGGGGGAAGGACC No data
Right 1136522523 16:30806018-30806040 TCCCGAGCACCAGCCTGGGAAGG No data
1136522510_1136522520 17 Left 1136522510 16:30805974-30805996 CCGAGCTCCCTGGGGGAAGGACC No data
Right 1136522520 16:30806014-30806036 ACCCTCCCGAGCACCAGCCTGGG No data
1136522510_1136522528 26 Left 1136522510 16:30805974-30805996 CCGAGCTCCCTGGGGGAAGGACC No data
Right 1136522528 16:30806023-30806045 AGCACCAGCCTGGGAAGGAGGGG No data
1136522510_1136522526 24 Left 1136522510 16:30805974-30805996 CCGAGCTCCCTGGGGGAAGGACC No data
Right 1136522526 16:30806021-30806043 CGAGCACCAGCCTGGGAAGGAGG No data
1136522510_1136522519 16 Left 1136522510 16:30805974-30805996 CCGAGCTCCCTGGGGGAAGGACC No data
Right 1136522519 16:30806013-30806035 CACCCTCCCGAGCACCAGCCTGG No data
1136522510_1136522527 25 Left 1136522510 16:30805974-30805996 CCGAGCTCCCTGGGGGAAGGACC No data
Right 1136522527 16:30806022-30806044 GAGCACCAGCCTGGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136522510 Original CRISPR GGTCCTTCCCCCAGGGAGCT CGG (reversed) Intergenic
No off target data available for this crispr