ID: 1136530552

View in Genome Browser
Species Human (GRCh38)
Location 16:30865613-30865635
Sequence CTACTGCCAGTACCTTGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136530552_1136530556 -7 Left 1136530552 16:30865613-30865635 CCAATTCAAGGTACTGGCAGTAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1136530556 16:30865629-30865651 GCAGTAGGACTCTAGGTGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136530552 Original CRISPR CTACTGCCAGTACCTTGAAT TGG (reversed) Intronic
902532504 1:17099351-17099373 CCACTGCCAGGACCTCAAATAGG + Intronic
908117166 1:60951554-60951576 TTTCTACCAGTAACTTGAATAGG - Intronic
918145539 1:181752802-181752824 CTATTGCCAGGACCTTTACTAGG + Intronic
918409964 1:184248270-184248292 TTCCTGCCAGGGCCTTGAATTGG + Intergenic
918967861 1:191374816-191374838 CTACTGACACTATTTTGAATAGG + Intergenic
920366011 1:205448763-205448785 CTGCTGCCAGTACCCAGGATGGG + Intronic
920678786 1:208057361-208057383 CTACTGCCAATAGATTTAATGGG + Intronic
1064299995 10:14114835-14114857 CTAATCCCAGTAGCTTAAATGGG - Intronic
1065196700 10:23273760-23273782 ATATTGCCAGTTCCTTGACTAGG + Intronic
1065627721 10:27648887-27648909 CTACTGCTAGTGCCTTCCATTGG - Intergenic
1066682779 10:37950512-37950534 TTGCTGCCAGTGCCTTGATTTGG - Exonic
1066756959 10:38721143-38721165 CTAATCCCAGTACCTTGGAAGGG - Intergenic
1067806427 10:49396164-49396186 CTACAGCGAGTAACTTGGATAGG + Intergenic
1072970898 10:100016513-100016535 CTACTTGCAGAAGCTTGAATTGG + Intergenic
1076117682 10:127911803-127911825 CTAGGGCCAGTACCTAAAATTGG - Intronic
1076692630 10:132231481-132231503 GCACTGCCAGTACCTTGCATGGG - Intronic
1079028385 11:16966873-16966895 CTACTGCCACCACCTTCACTGGG + Intronic
1080032293 11:27674521-27674543 GTACAGCCAGTTTCTTGAATAGG - Intronic
1080691652 11:34563742-34563764 CTCCTGCTGGTACCTTGCATTGG + Intergenic
1081520121 11:43873426-43873448 TTCCTGCCAATACCTTGATTTGG - Intergenic
1084982658 11:72839498-72839520 CTACTGCCAGTACCCTCGTTTGG - Intronic
1088991135 11:114954511-114954533 TCACTGGCAGTCCCTTGAATGGG + Intergenic
1093426766 12:19036534-19036556 CTACTTTCACTACCTTGATTTGG - Intergenic
1095967622 12:47879471-47879493 CTAGTGCCAGTAGCATGAATGGG - Intronic
1099686226 12:85892846-85892868 CTAATGCCAGCACATTGAGTGGG + Intergenic
1100884653 12:99056407-99056429 CTACTGCCATTACCCTGTTTAGG + Intronic
1103601032 12:122054716-122054738 ATACTGAAAATACCTTGAATCGG - Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106735103 13:32581000-32581022 ATACTGGCTGTAGCTTGAATAGG - Intergenic
1107368990 13:39721498-39721520 CCACTGGCAGTCCCTTGAGTGGG + Intronic
1110034197 13:70658348-70658370 TTGCTTCCAGTAACTTGAATTGG + Intergenic
1111538373 13:89634471-89634493 ATACTGCCAGTTCCTTAATTAGG - Intergenic
1114284879 14:21231766-21231788 GAACAGTCAGTACCTTGAATGGG - Intronic
1114796826 14:25725422-25725444 TTACTGCCAGTAACTTGTTTAGG - Intergenic
1117666673 14:58063028-58063050 GCCCTGCCAGTACCTTGATTTGG - Intronic
1119002115 14:70891788-70891810 CAGCTGCCAGTTCCTTGCATGGG - Intergenic
1121597340 14:95174595-95174617 CTACTGTAAATACTTTGAATTGG - Intergenic
1121662966 14:95649663-95649685 CACCTGGCAGTTCCTTGAATGGG - Intergenic
1130926644 15:88390607-88390629 CTACTGCTAGGAGCTGGAATAGG - Intergenic
1133517173 16:6520749-6520771 CAAGTGCCAGTCCCTTGATTTGG + Intronic
1135881705 16:26263827-26263849 TTCCTGCCAGTACCTTCCATTGG + Intergenic
1136530552 16:30865613-30865635 CTACTGCCAGTACCTTGAATTGG - Intronic
1137630615 16:49941135-49941157 CTTCAGCCACTACCTTGGATTGG - Intergenic
1139210313 16:65070677-65070699 CTAGTGCCAGCACCTGGTATAGG + Intronic
1142326171 16:89416222-89416244 CTGCTGACAGGACCTGGAATTGG - Intronic
1145413313 17:22692847-22692869 CCCCTGCCAGTTCCTAGAATCGG - Intergenic
1147937647 17:44022357-44022379 CTACTTCCAGTACACTGACTGGG + Intronic
1151307366 17:73271899-73271921 CAACTGCCAGAATCTAGAATTGG + Intergenic
1157763513 18:50281712-50281734 CAACTGCCAGTCCCTCGAAGGGG - Intronic
1162377026 19:10310762-10310784 CCACTTCCAGTTCCTGGAATGGG - Intronic
931101171 2:59002500-59002522 CTACTGCCACTACCTAGGTTTGG - Intergenic
935729754 2:106055611-106055633 CAACTGTCAGCCCCTTGAATTGG + Intergenic
936167212 2:110131768-110131790 CTACTGCCAGAAACATTAATTGG - Exonic
939480887 2:142745774-142745796 CTACTCCCAGTACTTTGAGAGGG + Intergenic
941070812 2:160952441-160952463 TTACTGCCAGGACCTTGCAACGG - Intergenic
944484847 2:200194806-200194828 CTACCCCCAGTACCTAGCATAGG - Intergenic
944794775 2:203171839-203171861 TTACTGACAGTACCAAGAATGGG - Intronic
1182917955 22:34052595-34052617 CTACTGCCAGTTCCATGTTTAGG - Intergenic
1183263177 22:36809317-36809339 CTAATCCCAGCACCTAGAATAGG - Intronic
1183367375 22:37414131-37414153 CTATCTCAAGTACCTTGAATGGG - Intronic
951598889 3:24350206-24350228 ATACTGCCAATACCTAGTATTGG + Intronic
952403280 3:32982977-32982999 CTACTGCCACTCCCTTGAAGTGG + Intergenic
953066754 3:39480287-39480309 CTGCTCCCAGAACCTAGAATAGG - Intronic
953579061 3:44136963-44136985 CTCCTGCAAGTTCCTTGTATTGG + Intergenic
953653839 3:44832241-44832263 TCACTGCCAGCACCTTGTATTGG - Intronic
954534423 3:51348307-51348329 CTACTGCCAAGTCCTTGAGTAGG + Intronic
956595713 3:70965005-70965027 GTACTGTCAGTTCCTAGAATAGG - Intronic
961081042 3:124028468-124028490 GTACATCCAGTACATTGAATAGG + Intergenic
962853012 3:139322089-139322111 CTCCTGCTGGTACCTTGCATTGG - Intronic
964167153 3:153722301-153722323 CTGCTGCCATAATCTTGAATTGG - Intergenic
964776791 3:160287882-160287904 CTAGTGCCTGTTCCTTGAACTGG - Intronic
966704335 3:182894663-182894685 CTTCTTCTAGGACCTTGAATGGG + Intronic
970781560 4:19743973-19743995 GTATTCCCAGTACCTTGAACAGG + Intergenic
971373189 4:26034679-26034701 CTCCTGCCAGTGCCTTTTATGGG + Intergenic
971657992 4:29374552-29374574 TTACTTACAGTACCCTGAATAGG - Intergenic
977238963 4:94543202-94543224 ATCCTGCCAGCACCTTGATTTGG - Intronic
978138934 4:105296204-105296226 CTACTCCAATTACCTTGCATAGG - Intergenic
980169510 4:129272046-129272068 ATACAGCCAGTAGCTTTAATAGG - Intergenic
981487785 4:145305318-145305340 CTTCTGCCAGTACCTTCTACTGG + Intergenic
981792032 4:148548964-148548986 CTAGAGCCAGTTCCTTGAAAGGG + Intergenic
985110312 4:186541179-186541201 CTACTGACACTACCTGAAATTGG + Intronic
985910715 5:2878566-2878588 CCATTTCCAGCACCTTGAATTGG + Intergenic
986451754 5:7872106-7872128 GTAATGTCAGTACCTTGAAAAGG - Intronic
993881003 5:93360981-93361003 TTAATGCCAGTAGTTTGAATGGG - Intergenic
994710105 5:103256182-103256204 CTCCTTCCAGTGCCTTGCATTGG - Intergenic
1000284406 5:159814820-159814842 TTACTGCCTGTACCCTGAATGGG - Intergenic
1002355246 5:178622958-178622980 CAACTGCCAGTAACGTGATTAGG - Intronic
1004177609 6:13353803-13353825 CTACTTCCTCTTCCTTGAATGGG - Intergenic
1004277996 6:14255067-14255089 ATACTGCCATTCTCTTGAATTGG + Intergenic
1005661853 6:28006140-28006162 CAACTGTTAGTACCTTGAAGAGG - Intergenic
1007320323 6:41023879-41023901 CTGCTGCCAGAACCTTGATATGG + Intergenic
1012328902 6:97959745-97959767 CTATTCCCAGTGCCTAGAATGGG - Intergenic
1012810345 6:103948926-103948948 CTACTGCCAGTACCCAGGATTGG + Intergenic
1016441734 6:144091474-144091496 CTACTGCTACAGCCTTGAATTGG + Intergenic
1017381585 6:153837717-153837739 CTCCTGCCACTACCATCAATGGG + Intergenic
1023823796 7:43995202-43995224 CGGCTGCCAGCCCCTTGAATAGG + Intergenic
1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG + Intergenic
1029752064 7:102548615-102548637 CGGCTGCCAGCCCCTTGAATAGG + Intronic
1029770016 7:102647709-102647731 CGGCTGCCAGCCCCTTGAATAGG + Intronic
1033741935 7:144282708-144282730 CTCCTGTGAGTACCTTGAAGTGG - Intergenic
1033751967 7:144366906-144366928 CTCCTGTGAGTACCTTGAAGTGG + Exonic
1037020900 8:13968904-13968926 ATCCTACCAGTACCTTCAATAGG + Intergenic
1037109707 8:15151168-15151190 CAACTGCCAATCCCGTGAATGGG + Intronic
1037661368 8:20929665-20929687 GCACTGCCAGTCCCGTGAATGGG - Intergenic
1043109221 8:76157367-76157389 GTCCTGCCTGTACCTTGATTTGG - Intergenic
1055356060 9:75438139-75438161 CTAGTGCCAGAATCTTGCATGGG - Intergenic
1057514166 9:95707020-95707042 CTGCTTCCAGTATCTTGCATGGG - Intergenic
1057702933 9:97376644-97376666 CTCTTGCCAGTGCCTGGAATGGG + Intronic
1057892765 9:98881683-98881705 GGACTGCCAGCACCTTGAACGGG - Intergenic
1059871220 9:118579937-118579959 CTACATCAATTACCTTGAATAGG + Intergenic
1196714423 X:118797832-118797854 ATACTACCAGTAACTTGAGTGGG + Intergenic
1199048436 X:143205975-143205997 CTAATGCCACTACCTTCCATGGG - Intergenic
1199557389 X:149123945-149123967 GTTCTGCCAGCACCTTGATTTGG + Intergenic
1200830064 Y:7680541-7680563 CTGCTGCCGGTACCTGGGATGGG - Intergenic