ID: 1136532149

View in Genome Browser
Species Human (GRCh38)
Location 16:30876866-30876888
Sequence TCTACCATAAGGAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136532145_1136532149 -9 Left 1136532145 16:30876852-30876874 CCAGCAGGGGCTTTTCTACCATA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 71
1136532144_1136532149 -3 Left 1136532144 16:30876846-30876868 CCAAATCCAGCAGGGGCTTTTCT 0: 1
1: 0
2: 0
3: 29
4: 201
Right 1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136532149 Original CRISPR TCTACCATAAGGAACTTGGT GGG Intronic
901329678 1:8396168-8396190 TCTACCATCAGGAAAGTGGGAGG + Intronic
905236066 1:36549396-36549418 TCTATCTTAAGAAACTGGGTGGG - Intergenic
906519051 1:46456620-46456642 GCTCCCATATGGAACTTGGAAGG - Intergenic
908832564 1:68193761-68193783 ACTACCTCAAGGAACCTGGTGGG + Intronic
910617026 1:89209579-89209601 TAGACAATCAGGAACTTGGTTGG - Intergenic
924147377 1:241090039-241090061 TCTTCCATAGGGATCTTGTTTGG + Intronic
1064742610 10:18449070-18449092 TTTAGCATAAGGAATTTGGTAGG - Intronic
1066140358 10:32499517-32499539 TCTCCCATAATGACCATGGTTGG - Intronic
1070528953 10:77319455-77319477 TCTACCTCAAGGAACTCTGTGGG - Intronic
1071699740 10:87917728-87917750 AATAGCATAAAGAACTTGGTGGG + Intronic
1081342787 11:41948229-41948251 TCTATCATAAGAAACTTACTTGG - Intergenic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1090511032 11:127375337-127375359 CCTACCAGAATGAACCTGGTAGG + Intergenic
1091001515 11:131913758-131913780 TGTTCCAGAAGGAACTTGGCTGG - Intronic
1092615982 12:10215953-10215975 TCTAACATAATTAACTTGGGGGG - Intronic
1092714034 12:11369712-11369734 TCTACCATAAGTCACTAGGCAGG - Intronic
1102946011 12:116988814-116988836 TACACCAAAAGCAACTTGGTTGG - Exonic
1117138095 14:52758144-52758166 CCTACCACAAGGGAATTGGTTGG + Intronic
1124349054 15:28942411-28942433 TTTCCCATAAGGAACTGTGTTGG + Intronic
1126481666 15:49129879-49129901 TCTAAAACAAGGAACTTGGCTGG - Intronic
1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG + Intronic
1137586203 16:49665177-49665199 TCTGCCATCAAGAGCTTGGTGGG + Intronic
1139418992 16:66836931-66836953 TTTACCATAGGGCACTGGGTGGG + Intronic
1139526231 16:67518515-67518537 TCAACCAGAAGGGACTTGGTGGG - Intronic
1142911526 17:3097646-3097668 TCTCCCTCAAGGAACTTGGCAGG - Intergenic
1148274359 17:46290289-46290311 TCTACAAAAAGGAATTTGCTGGG - Intronic
1149638484 17:58188192-58188214 TCTTCCATGTGGAAGTTGGTTGG + Intergenic
1150408695 17:64924282-64924304 TCTACAAAAAGGAATTTGCTGGG + Intergenic
1151035158 17:70790590-70790612 GCAAACATAAGGAAGTTGGTAGG - Intergenic
1154328254 18:13407828-13407850 CCTACCCTCAGGAACGTGGTGGG - Intronic
1159465962 18:68784724-68784746 TCTAACATAAGCAACATGTTAGG + Intronic
1161954852 19:7488017-7488039 TCAACCATATGGGACTTGATTGG + Intronic
1166500288 19:43335591-43335613 TCTACTTTCAGGAATTTGGTTGG + Intergenic
941031167 2:160513095-160513117 TCTACCAAAAGGAATTTAGGTGG + Intergenic
941522844 2:166570007-166570029 AATAACAAAAGGAACTTGGTAGG + Intergenic
943612616 2:190051552-190051574 TCTCCCATAAGAAACTTACTTGG + Intronic
944898900 2:204194718-204194740 GCCACACTAAGGAACTTGGTGGG - Intergenic
1177955070 21:27588094-27588116 TGTACAATAAGGAACATAGTGGG - Intergenic
1178063350 21:28875789-28875811 TCTACCTTAGTGAAATTGGTAGG - Exonic
1184244932 22:43231103-43231125 GGGACCACAAGGAACTTGGTGGG - Intronic
953270219 3:41435226-41435248 TCTACCATCAGGAGCATGGCTGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956726217 3:72158635-72158657 TCTACCAAAAGCATCTTGGTGGG - Intergenic
959893536 3:111582822-111582844 TCTCCCAGAAGGGACCTGGTGGG - Intronic
960187188 3:114658200-114658222 ACTACCTTAATGAACTTGCTTGG + Intronic
960926339 3:122798282-122798304 TCTACCATAAAAAACAAGGTTGG - Intronic
966587044 3:181637937-181637959 TCTGTCACAAGTAACTTGGTGGG - Intergenic
974629065 4:64459203-64459225 CCTACCCAAAGGAAATTGGTAGG + Intergenic
976712673 4:88089126-88089148 TGCACCATAAGAAACTTGTTTGG + Intergenic
978884701 4:113753511-113753533 TCTAGCATAGGGAAATTGGTAGG - Intronic
980023211 4:127733634-127733656 TTTAAAATAAGGAAGTTGGTAGG - Intronic
980915728 4:139031575-139031597 GCGACCATAAGGAAAATGGTCGG - Intronic
994563121 5:101402963-101402985 TCTACCTTAAGCCACTTGCTAGG + Intergenic
994656263 5:102596895-102596917 TCTACTGTTTGGAACTTGGTAGG - Intergenic
996362702 5:122668321-122668343 TCCAGCATAAGGACCTTGCTGGG + Intergenic
1000483937 5:161815319-161815341 TCAAACATAAGGAACTTGCAAGG + Intergenic
1004070371 6:12291984-12292006 GCTTCTACAAGGAACTTGGTAGG - Intronic
1006257304 6:32842084-32842106 TCATCCATAGGGAACATGGTGGG + Intronic
1010953856 6:82068617-82068639 TCTACCAAAAGGACCTTCCTGGG - Intergenic
1011261213 6:85471736-85471758 TCTATCATAAATGACTTGGTTGG - Intronic
1017226179 6:152023644-152023666 TCTAATATATGGAACTTGTTTGG - Intronic
1017529166 6:155270658-155270680 TCTAGCATAAGGAAGCTGGCTGG - Intronic
1018837797 6:167498302-167498324 ACCACCATAAGGAGCTGGGTGGG - Intergenic
1028368292 7:90060814-90060836 TTTACTATTAGGAAATTGGTAGG + Intergenic
1029437437 7:100571077-100571099 TCTACCCTAAGGGGCTGGGTGGG + Intergenic
1030120334 7:106104134-106104156 TCTACCACAGGGAATTGGGTAGG - Intronic
1036462860 8:8969530-8969552 TCTAAAAGATGGAACTTGGTTGG + Intergenic
1037924572 8:22834226-22834248 TTTCCCATACAGAACTTGGTGGG - Intronic
1045959797 8:107953687-107953709 TCTACCACTAGTAACTTGTTAGG + Intronic
1047907640 8:129489792-129489814 TCTAGCATAAACAACTTGATTGG - Intergenic
1051354800 9:16231885-16231907 TCTACAATAAGGAGGATGGTGGG + Intronic
1051494881 9:17709339-17709361 TCTGCGATTAGGAATTTGGTAGG - Intronic
1052137131 9:24926599-24926621 TCATCCATCAGGAACTTGGTAGG + Intergenic
1053557565 9:39153966-39153988 TCTGGCATCAGGAAATTGGTGGG + Intronic
1053821678 9:41974253-41974275 TCTGGCATCAGGAAATTGGTGGG + Intronic
1054139549 9:61464985-61465007 TCTGGCATCAGGAAATTGGTGGG - Intergenic
1054608892 9:67213157-67213179 TCTGGCATCAGGAAATTGGTGGG - Intergenic
1189038059 X:37513115-37513137 TATACCATAACGAACTTGGAAGG + Intronic
1190443924 X:50504012-50504034 TCTACCATAAGGCAGTTCGTTGG + Intergenic
1193041270 X:77006360-77006382 TCTAGAAAAGGGAACTTGGTGGG - Intergenic
1198198487 X:134389513-134389535 TCTACCACAAGGCACCTGGTTGG - Intronic