ID: 1136535397

View in Genome Browser
Species Human (GRCh38)
Location 16:30896464-30896486
Sequence AGCTCAGCTCCTCGTCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136535397_1136535407 8 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535407 16:30896495-30896517 AGGAATCCTGTCTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 201
1136535397_1136535406 7 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535406 16:30896494-30896516 AAGGAATCCTGTCTCAAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 207
1136535397_1136535414 29 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535414 16:30896516-30896538 GGGGTAGGATGAAATGTTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 183
1136535397_1136535408 9 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535408 16:30896496-30896518 GGAATCCTGTCTCAAAAGGGGGG 0: 1
1: 0
2: 2
3: 17
4: 129
1136535397_1136535411 14 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535411 16:30896501-30896523 CCTGTCTCAAAAGGGGGGGTAGG 0: 1
1: 1
2: 6
3: 20
4: 157
1136535397_1136535413 28 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535413 16:30896515-30896537 GGGGGTAGGATGAAATGTTTGGG 0: 1
1: 0
2: 1
3: 21
4: 382
1136535397_1136535404 5 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535404 16:30896492-30896514 CCAAGGAATCCTGTCTCAAAAGG 0: 1
1: 0
2: 2
3: 16
4: 167
1136535397_1136535409 10 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535409 16:30896497-30896519 GAATCCTGTCTCAAAAGGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 138
1136535397_1136535405 6 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535405 16:30896493-30896515 CAAGGAATCCTGTCTCAAAAGGG 0: 1
1: 0
2: 0
3: 18
4: 230
1136535397_1136535412 27 Left 1136535397 16:30896464-30896486 CCCCACGGACGAGGAGCTGAGCT 0: 1
1: 1
2: 1
3: 6
4: 80
Right 1136535412 16:30896514-30896536 GGGGGGTAGGATGAAATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136535397 Original CRISPR AGCTCAGCTCCTCGTCCGTG GGG (reversed) Intergenic
900793599 1:4694600-4694622 AGCTCATCTCCTTGTCAGTCTGG - Intronic
901022647 1:6262872-6262894 GGCTCAGCCACTCATCCGTGTGG - Intergenic
902754626 1:18540925-18540947 AGCACAGCGCCTGGTCCATGGGG + Intergenic
904813863 1:33181399-33181421 AGCACAGCAGCTCGTCCTTGAGG + Exonic
906231780 1:44170656-44170678 AGCTCAGCTCCTCCCCCTAGAGG - Intergenic
906312272 1:44762340-44762362 GGCTCAGCTCCTTGACCCTGAGG - Exonic
907518576 1:55008583-55008605 AACCCAGCTCCTTGTCCGGGAGG - Exonic
918404800 1:184201143-184201165 ATCTCAGCTCCTCTTCACTGGGG + Intergenic
1064190339 10:13200571-13200593 AGCTGAGCTCCTCGCCTCTGTGG + Intronic
1069504360 10:68984340-68984362 AGCTCAGCTCCTAATCCTTGAGG + Exonic
1072780583 10:98248656-98248678 AGCTGAGCTCCTCTTCTGTAAGG - Exonic
1073812376 10:107164740-107164762 AGCTCAGCTCCACCCCCGCGCGG - Intergenic
1076575478 10:131464012-131464034 AGCTCCGCCTCTCCTCCGTGTGG - Intergenic
1076864236 10:133159565-133159587 CTGTCAGCTCCCCGTCCGTGTGG - Intergenic
1092275921 12:7060885-7060907 AGCTCTGCTCCTCGTTTGTAAGG - Intronic
1096048728 12:48587064-48587086 AGGTCCGCTCCTGGGCCGTGGGG - Intergenic
1103821901 12:123705608-123705630 ATCTCAGCTCCTCTTCCTTTGGG + Intronic
1105368511 13:19782571-19782593 ACCCCATCTCCTCGTCCGGGTGG + Exonic
1113468120 13:110526112-110526134 AGCTCATCCCCTCCTCCCTGGGG + Intronic
1114306466 14:21428145-21428167 AGCTCTGCTCCTCATTCGGGGGG - Exonic
1119383557 14:74243298-74243320 AGCTCAGCTCCTCTTCAGACTGG + Intronic
1124656639 15:31514661-31514683 ACCTCTGCTCCCCATCCGTGAGG + Intronic
1128049512 15:64651606-64651628 TGCTCAGCTCCTGTTCAGTGTGG + Intronic
1128328042 15:66737813-66737835 GGCTCAGCTCCGCGTCACTGGGG - Intronic
1128851538 15:70962779-70962801 AGTTAAGCTCCTCCTCCTTGAGG - Intronic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1129694805 15:77734619-77734641 AGCTCTGCTCCTCCTCCAGGAGG + Intronic
1130562624 15:84970539-84970561 AGCTCAGGTCCCCATCTGTGAGG - Intergenic
1132058412 15:98669996-98670018 AGCTCAGCTCAGCATCCCTGGGG - Intronic
1132599263 16:766766-766788 AGCTCAGCTCCTCGGGGCTGAGG - Exonic
1136535397 16:30896464-30896486 AGCTCAGCTCCTCGTCCGTGGGG - Intergenic
1142764700 17:2058595-2058617 GGCTCAGCTGCTCGGCCGTGAGG - Exonic
1145881200 17:28353940-28353962 AGCTCAGCTGCTCCTCAGTTGGG + Intronic
1148471509 17:47896452-47896474 AGCCCCGCTCCTCCTCCGGGCGG - Intronic
1152387471 17:79983529-79983551 GGCTCAGCTCCCCGTGCCTGAGG - Intronic
1165112363 19:33509828-33509850 AGAACAGCTCCTCGGCGGTGGGG + Intronic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
927430991 2:23025996-23026018 GGAGCATCTCCTCGTCCGTGTGG - Intergenic
928352690 2:30574985-30575007 AGCTCAGGTCCTAGTCTGTGTGG + Intronic
934862406 2:97775299-97775321 GGCTGGGCTCCTCGTCCCTGGGG + Intronic
935671466 2:105560254-105560276 GGCTCCGCTCCTCATTCGTGGGG - Intergenic
935794563 2:106628777-106628799 AGCTCAGCCCCTCTTCTGTTTGG + Intergenic
936132464 2:109858315-109858337 AGCTCTGTTCCTCCTCCTTGTGG - Intergenic
936212233 2:110513170-110513192 AGCTCTGTTCCTCCTCCTTGTGG + Intergenic
936421373 2:112367737-112367759 AGCTCTGTTCCTCCTCCTTGTGG + Intergenic
938914327 2:135920016-135920038 AGCTCTGCTCCTTCTCTGTGTGG - Intronic
940732486 2:157408707-157408729 AGTTCTGCTCCTCTTCCTTGAGG + Intergenic
946133889 2:217629514-217629536 AGCCCAGCTCCTGCTCTGTGGGG - Intronic
948708594 2:239811151-239811173 AGCTCAGCTCCTGGGACTTGGGG - Intergenic
948838318 2:240636866-240636888 AGGTGAGCTCCTCGTGGGTGGGG - Intergenic
1176139052 20:63537230-63537252 AGCTCAGCTCCTCGTCCGTCCGG + Exonic
1179557577 21:42190272-42190294 ATCTCACCTCCTCGGCCCTGGGG + Intergenic
1179615328 21:42579747-42579769 AGCTCAGCTCCTTGTGTATGAGG - Exonic
1183544686 22:38449145-38449167 AGCTCAGCCACTCCTCCCTGTGG - Intronic
1184171938 22:42765098-42765120 AGCTCTGATCCGCGTCCCTGGGG - Intergenic
1184903239 22:47460947-47460969 AGTTCAACTCCTCCTCCTTGTGG + Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
974837899 4:67273222-67273244 ATCACAGCTCCTCGTCAGTAAGG - Intergenic
978489254 4:109294200-109294222 AGCTCAGTTCCTCCTCCTAGAGG + Intronic
987303336 5:16616707-16616729 AGCTCAGCAGCTCGTCGGCGCGG + Exonic
997103789 5:130995691-130995713 TGCTCACCTCCTCGTCGCTGTGG - Intergenic
998272452 5:140719022-140719044 AGTTCAGCTCCTTTTCCATGGGG + Intergenic
1001950002 5:175809676-175809698 ACCTCAGCTCCTCTTCCAGGTGG + Intronic
1006403464 6:33831052-33831074 AGCTGAGCTCCTCTTCCTCGTGG + Intergenic
1007830239 6:44632580-44632602 AGCTCTGCTCCTCTTTCGTAGGG + Intergenic
1013188892 6:107785357-107785379 AGATCAGCTCCTCAGCAGTGGGG - Intronic
1015133136 6:129836523-129836545 ATCACAGCTCCTCGCCAGTGAGG + Intronic
1015488554 6:133799821-133799843 AGACCAGCTCCTGGTCCCTGTGG + Intergenic
1018433833 6:163744001-163744023 AGCTCTGATCCTCCTCTGTGGGG + Intergenic
1018815941 6:167330954-167330976 AGCTCAGCTCCTTGTCCAGCCGG + Intronic
1024453763 7:49579814-49579836 AGCTCAGCTCCGCGTCCCTAGGG - Intergenic
1027590553 7:80113680-80113702 AGCTGAGCTTCTGGGCCGTGGGG + Intergenic
1032718599 7:134531961-134531983 AGCTCAGCTTCAGGTCCTTGAGG - Exonic
1032723428 7:134569466-134569488 AGCTCAGCTTCAGGTCCTTGAGG - Exonic
1034295607 7:149969453-149969475 AGCTCAGCTCCAAGTTAGTGAGG + Intergenic
1034499592 7:151440875-151440897 AGCTCATCTCCCCAGCCGTGTGG - Intergenic
1034810455 7:154127452-154127474 AGCTCAGCTCCAAGTTAGTGAGG - Intronic
1034998563 7:155593830-155593852 AGCTGAGCTCCTCGGCCCTCTGG + Intergenic
1036997813 8:13679240-13679262 AGCTCAGCTCCTGATCCTTGAGG + Intergenic
1053567914 9:39272332-39272354 AGATCAGCTCCTTTTCCCTGAGG + Intronic
1053833916 9:42113276-42113298 AGATCAGCTCCTTTTCCCTGAGG + Intronic
1054129232 9:61346672-61346694 AGATCAGCTCCTTTTCCCTGAGG - Intergenic
1054596634 9:67074133-67074155 AGATCAGCTCCTTTTCCCTGAGG - Intergenic
1059914336 9:119082298-119082320 AGCTCAGCTTTTGGTACGTGAGG - Intergenic
1061935796 9:133856944-133856966 AGCGCAGCACCTGGTCCTTGTGG - Intronic
1062056577 9:134472193-134472215 AGCTCAGCCCCTCCTGAGTGTGG + Intergenic
1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG + Intronic
1200142704 X:153909856-153909878 AGCTCAGCTCCTGGGCTGTGCGG + Exonic