ID: 1136536858

View in Genome Browser
Species Human (GRCh38)
Location 16:30904583-30904605
Sequence GCCGGCAGGATGGGACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136536850_1136536858 2 Left 1136536850 16:30904558-30904580 CCTGAGTCTCGCAGCCCCGAGCT 0: 1
1: 0
2: 0
3: 2
4: 101
Right 1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 227
1136536847_1136536858 18 Left 1136536847 16:30904542-30904564 CCAGCAGGCCTTGGGCCCTGAGT 0: 1
1: 0
2: 1
3: 26
4: 270
Right 1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 227
1136536846_1136536858 19 Left 1136536846 16:30904541-30904563 CCCAGCAGGCCTTGGGCCCTGAG 0: 1
1: 0
2: 0
3: 40
4: 303
Right 1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 227
1136536849_1136536858 3 Left 1136536849 16:30904557-30904579 CCCTGAGTCTCGCAGCCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 227
1136536848_1136536858 10 Left 1136536848 16:30904550-30904572 CCTTGGGCCCTGAGTCTCGCAGC 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 227
1136536843_1136536858 27 Left 1136536843 16:30904533-30904555 CCATATTGCCCAGCAGGCCTTGG 0: 1
1: 0
2: 2
3: 28
4: 304
Right 1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136536858 Original CRISPR GCCGGCAGGATGGGACTGCC AGG Intergenic
900339357 1:2180783-2180805 GGGGGCAGCATGGGACTCCCAGG - Intronic
900497890 1:2984610-2984632 CCCGGCAGGATGGCAGTGCTTGG - Intergenic
906535221 1:46547682-46547704 GCAGGCAGGATGGGAGGGCAGGG + Exonic
906731863 1:48089646-48089668 CCGGGCAGGATGAGACTCCCCGG + Intergenic
906903879 1:49867070-49867092 CCCGGCAGGACAGGACTGACTGG - Intronic
910839311 1:91546449-91546471 CCCGGAAGGCCGGGACTGCCAGG - Intergenic
911205934 1:95091540-95091562 GCCGGCGGGCTGGCACTGCTAGG - Intergenic
913491199 1:119381512-119381534 GCAGGGAGGATGGGCCTGCTGGG + Intronic
920286534 1:204883742-204883764 GCCAGCAGCATGGGATTGGCAGG + Intronic
920386817 1:205575449-205575471 GCAGGCAGGAATGGGCTGCCTGG + Intronic
920886997 1:209938560-209938582 GCCGGCAGGAGGCGGCGGCCCGG - Intronic
922985890 1:229865629-229865651 GCCGGCAGGCTGGCACTGCTGGG - Intergenic
924170998 1:241340941-241340963 TCTTACAGGATGGGACTGCCAGG + Intronic
1062760189 10:11832-11854 GCCGCCAGGGAGGGACTGCAGGG - Intergenic
1062904455 10:1170447-1170469 GCCAGCAGCAAGGGACTCCCAGG + Intergenic
1062910294 10:1207976-1207998 GCCTTCAGGATGGGACTGTTAGG + Intronic
1062957806 10:1551888-1551910 GCAGACAGAATGGGACTGACTGG + Intronic
1064869722 10:19924065-19924087 GCTGGCCGGTTGGGACTTCCGGG - Intronic
1067191010 10:44068335-44068357 GCCGACAGGATGGGACCACATGG + Intergenic
1067689666 10:48493682-48493704 GCCCGAAGGCTGGGACTGTCTGG + Intronic
1067832857 10:49620437-49620459 GCTGTCAGGATGGGACTGTTTGG + Intronic
1072335721 10:94396051-94396073 GCCGGCATGATGGCAGTGGCAGG + Intergenic
1074701774 10:116098623-116098645 GCCGGGAGCATTGGGCTGCCAGG - Intronic
1075948438 10:126457413-126457435 GCTGGCAGAATGGCACAGCCGGG + Intronic
1076369582 10:129943078-129943100 GCCTGCACGATGGGAATGACTGG + Intronic
1076769005 10:132652963-132652985 GCCAGCAGGAGGGGACTGTGGGG - Intronic
1077325032 11:1960016-1960038 GCACGCAGCATGGCACTGCCTGG - Intronic
1079413702 11:20213090-20213112 GACGTCAGGAAGGGACTGCGGGG - Intergenic
1080926328 11:36760331-36760353 GAAGGAAGGATGGGATTGCCAGG + Intergenic
1083273299 11:61582852-61582874 GCCAACAGGCTGGGACTGCAAGG + Intergenic
1083609450 11:63998131-63998153 CCCACCAGGATGGCACTGCCCGG - Exonic
1086962156 11:92989463-92989485 GCCCACAGGAAGGGACTGGCAGG - Intergenic
1088089884 11:106025122-106025144 GAGGGCAGAATGGTACTGCCAGG - Intergenic
1088704384 11:112448294-112448316 GCAGGCAGGATCTGTCTGCCTGG - Intergenic
1089202510 11:116732944-116732966 GCAAGCTGGATGGGGCTGCCCGG - Intergenic
1089533951 11:119149480-119149502 GCCGGCGGGAGGGGCCGGCCTGG + Intronic
1089800250 11:121021833-121021855 GCCGGTGGGCTGGCACTGCCGGG - Intergenic
1091154471 11:133360975-133360997 GCCGGGCGGGTAGGACTGCCAGG - Intronic
1092155414 12:6278858-6278880 CGCGGCAGGACGGGGCTGCCAGG - Intergenic
1093266282 12:17007797-17007819 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1093970227 12:25369540-25369562 GCCGGTAGGCTGGCACTGCTGGG - Intergenic
1093972971 12:25391602-25391624 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1094108795 12:26839346-26839368 GCTGGCAGGCTGGCACTGCTGGG - Intergenic
1096817160 12:54208837-54208859 GCCAGAAGGAGGGGGCTGCCTGG + Intergenic
1100142348 12:91634114-91634136 GCCGGTAGGCTGGCACTGCTGGG - Intergenic
1101782162 12:107845893-107845915 GCCGGCGGGATGCGGCTGGCGGG - Intergenic
1104763795 12:131313710-131313732 GCCTGCAGGACAGGACGGCCTGG - Intergenic
1105024288 12:132838220-132838242 GCCAGCAGGATGGGAGTGGTCGG - Intronic
1109854287 13:68107904-68107926 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1113508330 13:110832016-110832038 GCAGGCAGGATGGGCCATCCAGG + Intergenic
1114493501 14:23117776-23117798 GCCTTCAGGAGGGGACTGCAGGG + Exonic
1116044894 14:39732435-39732457 GCTGGCTGGTTGGGACTGCTGGG + Intergenic
1116311017 14:43326778-43326800 GCTGGCAGGCTGGCACTGCTGGG - Intergenic
1117727274 14:58687246-58687268 GCCCACAGCATGGGACTGGCAGG - Intergenic
1119031178 14:71193827-71193849 GCAGGCAGGATGGCACTCTCTGG + Intergenic
1119171512 14:72539553-72539575 GACGTCAGGAAGGGGCTGCCGGG - Intronic
1120229756 14:81829643-81829665 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1121786387 14:96664332-96664354 AAAGGCAGGAGGGGACTGCCTGG + Intergenic
1122615674 14:103016274-103016296 GCTGCCAGGATGGTACTGCTAGG + Intronic
1123078976 14:105682639-105682661 GGCGACAGGATCGGGCTGCCAGG + Intergenic
1123147059 14:106142215-106142237 GGAGACAGGAGGGGACTGCCTGG - Intergenic
1123945220 15:25235664-25235686 GCCTGCAGTATGGCACAGCCTGG + Intergenic
1123947721 15:25246920-25246942 GCCTGCAGCATGGCACGGCCTGG + Intergenic
1124360362 15:29032438-29032460 GCCGGCAGGCTGGGAACTCCAGG - Intronic
1126100277 15:45114542-45114564 GCCAGCAAGCTGGGGCTGCCTGG - Exonic
1127916457 15:63459259-63459281 GCCGGCAGGCCGGCACTGCTGGG - Intergenic
1128313842 15:66647727-66647749 GCCGCCAGGCTGGAACTGCTGGG - Intronic
1128751729 15:70154884-70154906 GCAGCCAGGCTGGGAATGCCAGG - Intergenic
1129763731 15:78147934-78147956 CACTTCAGGATGGGACTGCCAGG + Intronic
1130901100 15:88207248-88207270 GCCTCCAGGATGGCACTGCGGGG + Intronic
1131061865 15:89409419-89409441 TCCGGCATGATGGCACCGCCAGG - Intergenic
1132114540 15:99125888-99125910 GCCAGCAGGCTGGGTCTGCTGGG + Intronic
1132509210 16:328898-328920 GCGGGCAGGGAGGGTCTGCCAGG + Intronic
1132722709 16:1324622-1324644 GGCTGCAGGATGGGACCTCCTGG - Intronic
1133295556 16:4750262-4750284 GTCTGCAGAATGGGGCTGCCTGG - Exonic
1133961796 16:10501224-10501246 GCTGGCTGGTTGGGACTGCTGGG + Intergenic
1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG + Intergenic
1136605736 16:31332105-31332127 TCCGGCAGAAGGGAACTGCCTGG + Exonic
1136691888 16:32038884-32038906 GGGGACAGGAGGGGACTGCCTGG + Intergenic
1136792476 16:32982446-32982468 GGGGACAGGAGGGGACTGCCTGG + Intergenic
1136877341 16:33871461-33871483 GGGGACAGGAGGGGACTGCCTGG - Intergenic
1141034958 16:80618711-80618733 GCAGGCAAGGTGGGACTCCCAGG - Intronic
1141592983 16:85081028-85081050 GCAGGCAGGAGGGCACTGGCGGG - Intronic
1142306333 16:89287987-89288009 TCCGGCAGGACGGGGCTGTCAGG + Intronic
1203094682 16_KI270728v1_random:1243911-1243933 GGGGACAGGAGGGGACTGCCTGG + Intergenic
1142508373 17:380304-380326 TCCGGGAGGCTGGTACTGCCTGG - Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142995588 17:3758070-3758092 CCCAGCAGGAAGGTACTGCCTGG + Intronic
1144648558 17:16991524-16991546 GCCGGCAGCATGGGCATGCGGGG - Intergenic
1145067787 17:19773854-19773876 GCCGGGAGGAGGGGACTGTTAGG - Intronic
1146299895 17:31679642-31679664 GCTGGAAGGATGGGAGGGCCAGG - Intergenic
1147373633 17:40011108-40011130 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1148339185 17:46863244-46863266 GCCAGCAGGGTGGGACTGCAGGG + Intronic
1150574312 17:66416452-66416474 GCCGGCAGCTGGGGACTGACAGG + Intronic
1151235375 17:72716126-72716148 GCCTGCAGGTTGGGAATGCAGGG - Intronic
1152433305 17:80261015-80261037 GCCGGCAGGAAGAGGCGGCCGGG - Intronic
1152866900 17:82729554-82729576 GCCGTCAGGATGGACCTACCCGG - Intronic
1152953097 18:12186-12208 GCCGCCAGGGAGGGACTGCAGGG - Intergenic
1153665116 18:7361023-7361045 GCACGCAGCATGGGACTGGCGGG + Intergenic
1153985205 18:10344843-10344865 GGCTCCAGCATGGGACTGCCGGG + Intergenic
1154174511 18:12076641-12076663 GCCGGCAGCATGGAGCCGCCCGG - Intergenic
1155163926 18:23217947-23217969 CCCGGCAGGCTGGGGCAGCCCGG - Intronic
1156341166 18:36211859-36211881 GCCGGGAGGATGACACTGCATGG + Intronic
1157935172 18:51864552-51864574 GCCAGCAGGCTGGCACTGCTGGG + Intergenic
1161255694 19:3308038-3308060 CCCGGAAGAATGGAACTGCCGGG - Intergenic
1162230155 19:9259687-9259709 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1162233102 19:9283640-9283662 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1162337701 19:10071717-10071739 GCCACCAGGCTGGGGCTGCCAGG + Intergenic
1163560592 19:18017160-18017182 GCAGGCTGGCTGGGACAGCCTGG - Intergenic
1163668508 19:18614027-18614049 GCCGGCAGGGTGGGCCAGCGTGG + Intronic
1166369062 19:42291418-42291440 GACTGCAGGATGGGGATGCCAGG - Exonic
1166663535 19:44663026-44663048 GCCAGCAAGCTGGGACTGGCAGG + Exonic
928916490 2:36477465-36477487 GCCGGCAGGCTGAGACTGTCAGG - Intronic
929313565 2:40452131-40452153 GCCGGGAGGCTGGGAGGGCCGGG + Intronic
929782707 2:44967535-44967557 GCAGGCAGGATGAGACTCCCTGG + Intergenic
931775076 2:65533262-65533284 CCCTGCAGGGTGGGACTGGCTGG + Intergenic
931798157 2:65731790-65731812 GCCGGCAGGAAAGAACTACCTGG - Intergenic
932334567 2:70922662-70922684 GCCGGGAGGAGGGGAAGGCCGGG + Intronic
934976380 2:98805717-98805739 GCCACCAGCATGGGGCTGCCAGG + Intronic
937521695 2:122720499-122720521 CCAGGCAGGAATGGACTGCCTGG - Intergenic
937746606 2:125422422-125422444 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
938118819 2:128619892-128619914 GCGGGCAGGATGACACAGCCAGG + Intergenic
938134853 2:128748484-128748506 GCCGGGAGGATGCCACTCCCAGG - Intergenic
938289493 2:130141859-130141881 GCAGGCAGGAGGGGCCTCCCCGG - Intronic
938467037 2:131531079-131531101 GCAGGCAGGAGGGGCCTCCCCGG + Intronic
942178267 2:173355318-173355340 GCAGGCAGGCTGGCTCTGCCTGG - Intronic
944037085 2:195307949-195307971 GCAGGCAGGATGGCTCTGCAGGG - Intergenic
947955855 2:234190106-234190128 ACAGGCAGGATGCCACTGCCTGG + Intergenic
948682051 2:239641871-239641893 GCCCGCAGCCTGGCACTGCCTGG + Intergenic
948756913 2:240165369-240165391 GCCGACAAGATGGGAGGGCCTGG - Intergenic
1170703960 20:18728192-18728214 GCCGGCAAGAGGGCCCTGCCTGG + Intronic
1171404375 20:24900097-24900119 GTCGGCAGCATGGGCCTGCAGGG - Intergenic
1171951117 20:31423450-31423472 ACCAGCAGGATGGGAGTTCCTGG + Intergenic
1172772192 20:37388307-37388329 GCCAGGAGGCTGGGGCTGCCAGG + Intronic
1174664604 20:52246301-52246323 GTCAGCAGGATGGGACCCCCAGG - Intergenic
1175468695 20:59210359-59210381 GCCGGCGGGATGGGGCTCCGCGG + Intronic
1176155615 20:63618691-63618713 GATGGCAGCCTGGGACTGCCCGG + Intronic
1178054541 21:28783930-28783952 GCCGGCAGGCTGGCATTGCCGGG - Intergenic
1179713991 21:43278489-43278511 GCCAGCAGGACGGGTGTGCCAGG + Intergenic
1179886771 21:44317535-44317557 GCCTGCAGGCTGGGAGTGCATGG - Intronic
1180954864 22:19737039-19737061 GCCGGGTCGAGGGGACTGCCGGG + Intergenic
1182486318 22:30641200-30641222 TCCTGCAGGCTGGGGCTGCCTGG - Intronic
1183209410 22:36441628-36441650 GCCACCCGCATGGGACTGCCTGG - Intergenic
1185258154 22:49848198-49848220 GCCGGGGGGAAGGGACTGCGCGG - Intergenic
950141943 3:10621575-10621597 GCCAGAAGGAAGGGACAGCCTGG - Intronic
950419190 3:12886931-12886953 GCCAGCAGGCTGGGGCTGGCAGG - Intergenic
951551874 3:23882722-23882744 GCTGGCAGGCTGGCACTGCTGGG + Intronic
952386022 3:32842297-32842319 GCATGCGGGATGGGACTTCCTGG - Intronic
953556435 3:43950053-43950075 GCAGGCTGGCTGGGACTGCATGG + Intergenic
955186435 3:56719106-56719128 GCCGGCAGGCTGGCACTGCTGGG - Intergenic
955518187 3:59748726-59748748 GCCTTTAGGGTGGGACTGCCTGG + Intergenic
960714007 3:120558399-120558421 GCCAGCAGGACGGGTCTTCCAGG - Intergenic
964014389 3:151928329-151928351 GCCGGTGGGCTGGCACTGCCGGG - Intergenic
965370352 3:167854406-167854428 GCAGACAGGATGGGACTGTGAGG - Intergenic
967834738 3:193951441-193951463 GCCAGCAAGATGGGGCTGTCAGG - Intergenic
968549121 4:1213429-1213451 GCTGGCAGGAAGGGACCCCCAGG + Intronic
968698675 4:2044607-2044629 GCAGGCTGGAGGTGACTGCCAGG + Intergenic
968758611 4:2429442-2429464 GCCGGTAGGATCGGTGTGCCAGG - Intronic
968817453 4:2829329-2829351 GAAGGCAGGATGGGAGTGCTGGG + Intronic
968950192 4:3687477-3687499 CGCGGCAGGATGGGACTCCATGG + Intergenic
969440752 4:7215303-7215325 GCCGGTAGGCTGGCACTGCTGGG - Intronic
970803538 4:20004186-20004208 GCCGGTGGGATGGCACTGCTGGG - Intergenic
972396692 4:38664211-38664233 GCCGGCGTCATGTGACTGCCCGG + Exonic
973758387 4:54096578-54096600 GCAGGCAGGGCGGGACAGCCGGG - Intronic
977244790 4:94618672-94618694 AGCAGCAGGATGGAACTGCCTGG + Intronic
980148164 4:129015082-129015104 GCTGGCAGGGTGGGACTGGCTGG + Intronic
980230243 4:130038728-130038750 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
980470220 4:133240594-133240616 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
980799767 4:137733910-137733932 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
983369704 4:166842813-166842835 GCCGGCAGTGCGGGACTGGCAGG - Intronic
985644629 5:1079102-1079124 GCCGGCAGGCTGGGCCCGCGGGG - Intronic
986292337 5:6410282-6410304 GCTGGGAGGATGCTACTGCCTGG + Intergenic
986806604 5:11313558-11313580 CCTGGCAGGATGGGTCTTCCCGG + Intronic
987146238 5:14993991-14994013 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
987315307 5:16718126-16718148 GCCGGTGGGCTGGCACTGCCTGG - Intronic
987332168 5:16866928-16866950 GCTGGCAGGAGGGGACCACCTGG - Intronic
990753192 5:59039733-59039755 GCCGGGGGGATGGCACTGCGAGG - Intronic
990760874 5:59127879-59127901 GCCGGCAGAAGGAGACTGTCTGG - Intronic
991643812 5:68780470-68780492 GTTGGCAGGAGGGGACTGCAGGG - Intergenic
994701689 5:103142220-103142242 GCCGGTGGGCTGGCACTGCCGGG + Intronic
995254227 5:110028230-110028252 GCTGGGAGGATGGGATTTCCAGG - Intergenic
996862750 5:128084039-128084061 GCAGCCAGGGTGGAACTGCCCGG + Exonic
997521619 5:134527171-134527193 GCCGGGAAGATGCCACTGCCGGG - Intronic
1001503290 5:172255678-172255700 GCCGGCATCATGTGACTGCCTGG - Intronic
1002193160 5:177489346-177489368 GGCTGCAGGATGGGAAAGCCAGG + Intronic
1003114668 6:3275977-3275999 GCAGGGAGGATGGGAGTCCCAGG + Intronic
1003671551 6:8164508-8164530 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1003770145 6:9290625-9290647 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1004217591 6:13716926-13716948 GCCGGCAGGCCGGCACTGCTGGG - Intergenic
1005117721 6:22356592-22356614 GCTGGCAGGCTGGCACTGCTGGG + Intergenic
1006005781 6:31000640-31000662 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1006640003 6:35484987-35485009 GCTGGGAGGATGGGCGTGCCTGG - Intronic
1006696021 6:35931445-35931467 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1007507092 6:42344024-42344046 GCAGGCAGGAAGGCACTGCATGG + Intronic
1008520929 6:52362099-52362121 GCCGGGAGGAGGAGACCGCCGGG - Intronic
1013808718 6:114020519-114020541 GCAGGCAGGCTGGGGGTGCCAGG + Intergenic
1014055898 6:117014930-117014952 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1014537954 6:122638842-122638864 GCCAGCAGGATGAATCTGCCAGG - Intronic
1015600356 6:134904906-134904928 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1016203714 6:141446410-141446432 GCCGACAGTGTGGGACTGCAAGG - Intergenic
1018674424 6:166206624-166206646 ACTGGAAGGATGGGCCTGCCTGG - Intergenic
1019269527 7:139263-139285 GCCAGCAGGAGTGGCCTGCCTGG - Intergenic
1019296220 7:276723-276745 GCAGGCAGGATCTGCCTGCCTGG - Intergenic
1019602249 7:1890615-1890637 ACTGGCAGGATGGGCTTGCCTGG - Intronic
1019629624 7:2041399-2041421 GCTGGCAGGTTGGGGCTGGCAGG - Intronic
1019670761 7:2277018-2277040 CCCGGCCGGACGGCACTGCCAGG - Intronic
1022165100 7:27751695-27751717 GCAGGCAGGAAGAGAGTGCCTGG + Intronic
1023377999 7:39577575-39577597 GCCGGCAGGCTGGCACTGCTGGG - Intronic
1030780423 7:113593494-113593516 GCCGGTGGGATGGCACTGCTGGG - Intergenic
1031920921 7:127600076-127600098 GCAGGCAGGATGGGGCAGCTAGG + Intronic
1031993295 7:128211567-128211589 GCAAGCAGGATGGGAACGCCAGG + Intergenic
1032306190 7:130734026-130734048 GCCGACATGCTGGGACCGCCCGG + Exonic
1034522596 7:151632242-151632264 GCCGGGAGGAGGGGCCTGGCAGG + Intronic
1035616049 8:1002757-1002779 GCTGACAGGAAGAGACTGCCTGG + Intergenic
1036065901 8:5380989-5381011 GCCAACAGGATGTGACTGCGTGG + Intergenic
1037417567 8:18667869-18667891 GCCGGCAGGCCGGCACTGCTGGG + Intronic
1037744351 8:21630992-21631014 GACGGCAGCGTGGGACTTCCGGG - Intergenic
1037759608 8:21733239-21733261 GCCTGCAGGGTGGGTCTGCGTGG - Intronic
1037804917 8:22053797-22053819 GCAGGCAGGAGGCGGCTGCCAGG - Intronic
1038483293 8:27916574-27916596 GACAGCAGTATGGGAATGCCTGG + Intronic
1041085586 8:54253477-54253499 CCCAGCAGGATGGGAGTGGCTGG - Intergenic
1041099088 8:54378751-54378773 CGCTGCAGGATGGGACTGGCTGG + Intergenic
1047961632 8:130015983-130016005 GCTCGCAGGAAGGGTCTGCCAGG + Intronic
1048982139 8:139708320-139708342 GCTATCAGGATGGGAATGCCAGG - Intergenic
1049202483 8:141347121-141347143 GCCGGCAGGATTGAAGTGCCTGG - Intergenic
1055787442 9:79885426-79885448 GCTGGCAGGTTGGGACTACATGG - Intergenic
1056667547 9:88593002-88593024 GCCGGCAGGCTTGTGCTGCCTGG - Intergenic
1056710683 9:88990414-88990436 GCCGGCAGGATTGGGCCGCAGGG - Intergenic
1056732464 9:89178072-89178094 GCCGCCAGGAAGGGCCGGCCCGG - Exonic
1057057189 9:91972517-91972539 GCCTGCAGAATGACACTGCCTGG - Intergenic
1060292895 9:122320471-122320493 GCTGGCAGCCTGGGACAGCCAGG - Intronic
1061475490 9:130863032-130863054 GAAGGTAGGCTGGGACTGCCGGG + Exonic
1062363364 9:136197793-136197815 GCCTGCAGGATGGGACTCTGAGG - Intronic
1062453783 9:136626502-136626524 ACCTGCAGGGTGGGACTGCGGGG + Intergenic
1187904021 X:24049866-24049888 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1188513085 X:30957809-30957831 GCAGGCATGCTGGAACTGCCTGG - Intronic
1189182079 X:39014062-39014084 GCCAGCAGGAAGGGCCAGCCTGG - Intergenic
1191179590 X:57545995-57546017 GCTGGCAGGAGGGAACTGCCTGG + Intergenic
1200055450 X:153457641-153457663 GCCGACAGGATGGGGCTGAGAGG + Intronic
1200089576 X:153628008-153628030 CCCGGGAGGCTGGGACTGCCAGG + Intergenic