ID: 1136540204

View in Genome Browser
Species Human (GRCh38)
Location 16:30924314-30924336
Sequence GAGGGGCCGAGCGCCCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136540187_1136540204 9 Left 1136540187 16:30924282-30924304 CCACTCGCCGCCGTCCCGGCCTC 0: 1
1: 0
2: 2
3: 32
4: 381
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540196_1136540204 -6 Left 1136540196 16:30924297-30924319 CCGGCCTCCGCCGGAGGGAGGGG 0: 1
1: 0
2: 2
3: 20
4: 233
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540182_1136540204 18 Left 1136540182 16:30924273-30924295 CCCCCATCTCCACTCGCCGCCGT 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540189_1136540204 2 Left 1136540189 16:30924289-30924311 CCGCCGTCCCGGCCTCCGCCGGA 0: 1
1: 0
2: 2
3: 19
4: 210
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540194_1136540204 -5 Left 1136540194 16:30924296-30924318 CCCGGCCTCCGCCGGAGGGAGGG 0: 1
1: 0
2: 3
3: 23
4: 227
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540179_1136540204 26 Left 1136540179 16:30924265-30924287 CCCGGCGCCCCCCATCTCCACTC 0: 1
1: 0
2: 2
3: 21
4: 375
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540177_1136540204 28 Left 1136540177 16:30924263-30924285 CCCCCGGCGCCCCCCATCTCCAC 0: 1
1: 0
2: 0
3: 41
4: 410
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540185_1136540204 15 Left 1136540185 16:30924276-30924298 CCATCTCCACTCGCCGCCGTCCC 0: 1
1: 0
2: 1
3: 21
4: 309
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540178_1136540204 27 Left 1136540178 16:30924264-30924286 CCCCGGCGCCCCCCATCTCCACT 0: 1
1: 0
2: 3
3: 16
4: 288
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540180_1136540204 25 Left 1136540180 16:30924266-30924288 CCGGCGCCCCCCATCTCCACTCG 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540198_1136540204 -10 Left 1136540198 16:30924301-30924323 CCTCCGCCGGAGGGAGGGGCCGA 0: 1
1: 0
2: 1
3: 13
4: 143
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540191_1136540204 -1 Left 1136540191 16:30924292-30924314 CCGTCCCGGCCTCCGCCGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540184_1136540204 16 Left 1136540184 16:30924275-30924297 CCCATCTCCACTCGCCGCCGTCC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540181_1136540204 19 Left 1136540181 16:30924272-30924294 CCCCCCATCTCCACTCGCCGCCG 0: 1
1: 0
2: 1
3: 8
4: 182
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1136540183_1136540204 17 Left 1136540183 16:30924274-30924296 CCCCATCTCCACTCGCCGCCGTC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136540204 Original CRISPR GAGGGGCCGAGCGCCCTCGG GGG Intronic
900106026 1:981484-981506 GATGGGACCAGTGCCCTCGGGGG + Intronic
900192428 1:1357077-1357099 GAGGGTCCAAGGACCCTCGGGGG - Intronic
900376848 1:2358871-2358893 GAGGAGCAGAGAGCCCACGGAGG - Intronic
902864396 1:19268865-19268887 GAGGGGCCCAGCATCCTGGGTGG - Intergenic
902869633 1:19306311-19306333 GAGGGGCCCAGCATCCTGGGTGG - Intronic
903694646 1:25197787-25197809 GACAGGTCGAGGGCCCTCGGCGG + Intergenic
906759372 1:48360728-48360750 GAGGGGCCAAGGGCCCTGGGAGG + Intronic
907276477 1:53319647-53319669 GAGGGGCTGAGGGCCTTCAGGGG - Intronic
908257988 1:62318469-62318491 GCTGGGCAAAGCGCCCTCGGCGG + Intronic
910835198 1:91501337-91501359 GAGGGGCCGAGCGCCGGGGGCGG - Intronic
910876906 1:91886265-91886287 GGGCGGCCGAGAGCCCCCGGTGG - Exonic
911219778 1:95234334-95234356 GAGGGACAGGGCGCCCTCAGGGG + Intronic
912911083 1:113759556-113759578 CAGGGGCGGAGCCACCTCGGCGG - Intergenic
915313931 1:155017682-155017704 GAGTGGGCGAGCGCCCCCCGCGG + Exonic
920071446 1:203305762-203305784 GAGGGGCCTGGCGCCACCGGGGG + Intronic
1062950856 10:1502187-1502209 GAGGGGCCGGGCCCCCACTGAGG - Intronic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1069544632 10:69319345-69319367 GAGGGTCCGAGCGCCGTGGGAGG + Intronic
1077096153 11:799985-800007 GAGGGTCCGAGGGGCCACGGCGG - Exonic
1077254535 11:1574322-1574344 GGGGGGCAGAGTGCCCTGGGCGG + Intergenic
1079459660 11:20669059-20669081 GGGGGTCCGTGCGCGCTCGGTGG + Intergenic
1083232397 11:61331597-61331619 GACGGGCCGAAGCCCCTCGGCGG + Exonic
1084517189 11:69643355-69643377 GCGGGGCCGCCCTCCCTCGGAGG - Intronic
1090817954 11:130314961-130314983 GCGGGGCGGAGCGCGCTCGGGGG + Intergenic
1090827606 11:130398765-130398787 GAGGGGCTGAGCGCCTTGAGAGG + Intergenic
1091225982 11:133956637-133956659 GAGGGGCCGAGGGCGCCGGGAGG + Intronic
1091778618 12:3200284-3200306 GCGGGGCCGAGGGCCCGGGGAGG + Intronic
1096460875 12:51820995-51821017 GAGGAGGCGCGCGCCCTCGGCGG + Intergenic
1096489922 12:52007647-52007669 GAAGGTCCGAGAGCCCCCGGTGG + Intronic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1097891451 12:64781116-64781138 GCGGGGCCGAGGGCCGCCGGCGG + Intergenic
1100391561 12:94149311-94149333 GAGGGGGCGGCCGGCCTCGGGGG + Exonic
1103120670 12:118376908-118376930 GAGGGGCGGGGCGGCCTCCGGGG + Intronic
1103558292 12:121779001-121779023 GATAGGCCCAGCCCCCTCGGTGG + Exonic
1103749940 12:123151379-123151401 CAGCAGCCGAGCGCACTCGGGGG + Intergenic
1106251748 13:27987209-27987231 GAGGGGCAGAGAGGCCTCTGTGG - Intronic
1113790898 13:113027628-113027650 GAGCGGCCGAGCTCCCTGAGGGG + Intronic
1116835902 14:49768707-49768729 CAGGCGGGGAGCGCCCTCGGCGG - Intronic
1117131865 14:52695321-52695343 GAGGGTCCCGGCGCCCTCCGCGG - Intronic
1122131008 14:99604456-99604478 GAGGGGCGGGGCGCGCGCGGGGG + Intergenic
1125019688 15:34972220-34972242 TAGGGGCTGGGCGCCCCCGGTGG - Intergenic
1128067876 15:64775640-64775662 GAGGGGGCGGGCGCCGGCGGCGG + Intergenic
1128248883 15:66151342-66151364 GTGGGGCTGAGCCACCTCGGGGG + Intronic
1131261795 15:90891492-90891514 GAGGGGGCGTGAGCCCTGGGAGG - Intronic
1131969302 15:97875861-97875883 GCGGGGACGAGCTCCCTCTGAGG + Intergenic
1132301516 15:100779091-100779113 AGGGGGCCGAGGCCCCTCGGAGG + Intergenic
1132398025 15:101488938-101488960 GAGGGGCCGCTCCCCCGCGGGGG + Intronic
1132612192 16:822702-822724 GAGGGCCCGAGCGTCCTCCAGGG - Intergenic
1132778517 16:1610518-1610540 GAGGGGCCGCGGGGACTCGGCGG + Intronic
1133033831 16:3023882-3023904 GAGGGGCCCAGCGCCTCCCGCGG - Exonic
1134014415 16:10878574-10878596 CAGGGGCCATGTGCCCTCGGAGG + Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1136271903 16:29153541-29153563 GAAGGGCCCAGAGCCCCCGGAGG - Intergenic
1136458297 16:30394964-30394986 GAGAGGCCGAGGGCCCGGGGTGG - Intronic
1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG + Intronic
1140522563 16:75594281-75594303 GAGGGGCCTTGCTCACTCGGTGG - Intergenic
1144753585 17:17666611-17666633 GTGGGGCTGTGCCCCCTCGGAGG + Intergenic
1146675986 17:34774252-34774274 GAGGGGCTGAGTGCCTTGGGCGG + Intergenic
1146956197 17:36937544-36937566 GACGCGCCGAGCGCCCGCGCTGG - Exonic
1148123266 17:45224460-45224482 GAGGGGCCCACCGCCATCAGTGG + Intronic
1150722908 17:67628631-67628653 GAGCAGCAGAGCGCCCTCTGGGG + Intronic
1152721923 17:81927564-81927586 GCGGGGCCGCGCGCGCTCCGAGG + Exonic
1152750916 17:82062079-82062101 GAGGGGCAGAGGGGGCTCGGAGG - Intronic
1154241467 18:12657608-12657630 GCGCGGCCGAGCGCACACGGTGG + Exonic
1159862761 18:73669056-73669078 GAAGGGCCGGGCTCTCTCGGAGG - Intergenic
1159920925 18:74226822-74226844 GTGGGGCCGCGCTCCCTCTGAGG + Intergenic
1160147383 18:76376193-76376215 GAGGTGCCGAGCCCCCTCACCGG + Intronic
1163607086 19:18281438-18281460 GAGGCGCTGAGCGGCCTGGGCGG - Exonic
1165061348 19:33206740-33206762 GAGGGGCCTCACGCCCTCCGGGG - Intronic
1165828215 19:38717646-38717668 GAGGGGCAGTGCGCCCTGGACGG + Intronic
1167607877 19:50491221-50491243 GAGGCCCCGAGGCCCCTCGGAGG - Intergenic
924987717 2:287556-287578 GTGGGGCCGAGCGCGCCCGAGGG - Intronic
925382004 2:3434955-3434977 GAGGAGCCGATCACCCTCTGTGG + Intronic
925399121 2:3558892-3558914 GAGGGGACGCGCCCCTTCGGGGG - Intergenic
925856412 2:8133565-8133587 GTGGGGAAGAGCGCCCCCGGGGG - Intergenic
926089995 2:10043523-10043545 GAGGGGCGGGGCGGCCGCGGAGG - Intronic
927053469 2:19350790-19350812 GTGGGGGCGGGCGCCCTGGGAGG - Intergenic
929775513 2:44928876-44928898 GAGGGGCCGAGAGGCCGTGGAGG + Intergenic
931429211 2:62196073-62196095 GCGGGGCCGGGCGCCCGCGGCGG + Intergenic
931671611 2:64653485-64653507 GAGGGGCCGGGCGCCGCCGCGGG - Intronic
937978060 2:127593491-127593513 GTGGGGCAGAGACCCCTCGGCGG - Intronic
938265225 2:129923426-129923448 GAGGGTCCCAGCGCCCCCTGGGG - Intergenic
941119082 2:161507772-161507794 GAGGGGGCGAGCGCTGGCGGTGG - Intronic
944060092 2:195563196-195563218 GAGGGGCGGGGGGCCCTAGGGGG - Intergenic
947641257 2:231708965-231708987 AGTGGGCCGGGCGCCCTCGGGGG + Intronic
1171065030 20:22007166-22007188 GAGGGGCCAAGAGCCATCCGGGG + Intergenic
1171421894 20:25023118-25023140 GAGAGGCTGAGTGCCCTCGGTGG - Intronic
1172781738 20:37440416-37440438 GAGGGTCCCAGTGCCCTTGGGGG - Intergenic
1175238022 20:57526426-57526448 GAGGGGAAGAGGGCCCTCAGGGG + Intergenic
1175416562 20:58805121-58805143 GAGGGGCTGGGCTCCCTCAGGGG - Intergenic
1178773168 21:35524685-35524707 GAGGGGCTGGGAGCCTTCGGTGG - Intronic
1179800819 21:43810807-43810829 GAGGGCCAGACTGCCCTCGGTGG - Intergenic
1179951777 21:44712282-44712304 GAGGGGCTGGGCTCCCTCGGAGG + Intergenic
1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG + Intergenic
1180093120 21:45542620-45542642 GAGGGGCCGCGTGACCCCGGCGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180955004 22:19737646-19737668 GATGGGCTGAGGGCCCTGGGGGG - Intergenic
1180984322 22:19895506-19895528 GAGGGGCTGTGCCCCCTCGCGGG - Exonic
1182301651 22:29340436-29340458 CAGGGGCTGTGCGACCTCGGAGG + Intronic
1183606105 22:38867478-38867500 GAGTGGCCCAGGGCCCTCTGTGG - Intronic
1185020744 22:48373455-48373477 GAGGGGCCAAGCAGCCTCTGAGG + Intergenic
1185420688 22:50732618-50732640 GGGGGGCTGGGCACCCTCGGGGG - Intergenic
952476795 3:33718376-33718398 GTTGGGCCGAGCCCCCTGGGAGG + Intergenic
954264056 3:49459755-49459777 GTGGGGCCGAGCAGCCTAGGAGG - Intergenic
954450252 3:50567708-50567730 GCCGGGCCGAGCAGCCTCGGGGG + Exonic
954663607 3:52238915-52238937 GAGGGGCCGAGAGCCGGGGGGGG + Intronic
959944825 3:112115350-112115372 GAGAGGCCCAGGGCCCTGGGAGG + Intronic
961934406 3:130568344-130568366 GTTGGGCCGGGCGCCCTTGGTGG - Exonic
963827539 3:149971051-149971073 GGGCGGCCGAGCGCGCTCTGAGG - Exonic
966787756 3:183636129-183636151 GCGGGGCCGGGCGCCGCCGGGGG + Intronic
968221453 3:196942956-196942978 GTGGCCCCGAGCGGCCTCGGAGG - Intergenic
969930746 4:10628566-10628588 GAGGGGCTGAGGGGCCTTGGAGG + Intronic
984778847 4:183505828-183505850 GAGGGGGCGAGAGGCCGCGGAGG + Intronic
985995774 5:3596148-3596170 GCGGGGCCGGGCGCCTACGGCGG + Exonic
986652181 5:9975095-9975117 GAGGTGCCGAGCCACCTCTGCGG - Intergenic
992962759 5:81972204-81972226 GAGGGACCCAGCGCCCTGCGAGG - Exonic
993501782 5:88674329-88674351 CAGGGGCCGACGGCACTCGGCGG - Intergenic
998307910 5:141096941-141096963 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998308546 5:141102794-141102816 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998310453 5:141124140-141124162 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998312892 5:141152396-141152418 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998315655 5:141180182-141180204 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998316196 5:141184704-141184726 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998316758 5:141189463-141189485 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998317392 5:141194703-141194725 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998318058 5:141201919-141201941 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998319585 5:141216268-141216290 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998320564 5:141225650-141225672 GAGGAGCAGGGCGGCCTCGGTGG + Exonic
998366688 5:141636941-141636963 GAGGGGCGGAGCTCCCCTGGGGG - Intronic
998463564 5:142325978-142326000 GAAGGGCCGTGGGCCTTCGGTGG - Intronic
999218345 5:149954708-149954730 GAAGGGCCGAGCCCCCTCTAGGG + Intergenic
999399353 5:151252800-151252822 GAGGGGCCGAGCGGAGTCGGGGG - Intronic
1001596754 5:172903383-172903405 GAGGGGCCGGTGGCCCTCAGTGG - Intronic
1002927217 6:1611481-1611503 TAGGCGCCGAGCGCCAGCGGGGG - Exonic
1003868022 6:10381316-10381338 GCGGGGCCCAGCGCCCTCTAGGG - Intergenic
1004174602 6:13328695-13328717 AAGGGGCCGGGTGCCCACGGCGG - Intergenic
1005165652 6:22917169-22917191 GAGGGTAAGAGAGCCCTCGGAGG - Intergenic
1006624403 6:35387074-35387096 AAGGGGCCCAGGGCCCTCTGTGG - Intronic
1006671501 6:35732143-35732165 GAGGGGGCCAGCGCCCCCAGAGG - Intergenic
1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG + Intronic
1016034624 6:139373676-139373698 GCGGGGGCCAGCGCGCTCGGGGG + Exonic
1018039187 6:159906596-159906618 GAGTGGCCGAGTGCCCTGTGCGG - Intergenic
1018626952 6:165789043-165789065 GAGGGGCAGAGCATCCTCTGTGG + Intronic
1019448950 7:1086606-1086628 GAGGGGCCGAGTGCCCCTGGAGG + Intronic
1019448974 7:1086683-1086705 GAGGGGCCGAGTGCACCTGGAGG + Intronic
1020261093 7:6531199-6531221 GAGGGGCCGCGCGCGCTCGCAGG - Intronic
1024255483 7:47537244-47537266 GAGGGGCCAAGGGCTCTCCGTGG + Intronic
1028838039 7:95396378-95396400 GCGGCGCCGAGAGCTCTCGGGGG + Intergenic
1029896659 7:103990236-103990258 GAGGGGCCGGGCGGCCGCGGCGG - Intergenic
1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG + Intergenic
1034680691 7:152925480-152925502 GAGGGGCCGGGCGCGCGCGGGGG + Intergenic
1035291288 7:157840877-157840899 GAGGGGCTGGGCGCCCTCTCAGG + Intronic
1035637117 8:1155670-1155692 GAGGGGCCTGGGGGCCTCGGAGG - Intergenic
1036787416 8:11697478-11697500 GAGGGGAGCAGCGCTCTCGGTGG + Intronic
1038828537 8:31033131-31033153 GAGGGGCCGAGAGCTGGCGGTGG - Exonic
1045305451 8:100952797-100952819 GAGGGGCCGCGCGCCCCGGTCGG - Intronic
1049083065 8:140457688-140457710 GCGGGGCCGAGCAGCCTCTGCGG + Intronic
1049276332 8:141721831-141721853 GAGGGACAGAGCACCCTGGGGGG + Intergenic
1049365582 8:142235321-142235343 GCGGGCCCCAGCGCCCTCGTCGG + Intronic
1049402299 8:142433883-142433905 GAGGGGCAGAGCGCGCTGGAGGG - Intergenic
1049403423 8:142440940-142440962 GAGGGGCCGAGGGCCTTCTTTGG + Intergenic
1049427740 8:142544847-142544869 GAGGGGCCTAGGGCCCTGGAAGG - Exonic
1049746534 8:144265528-144265550 GAGGGGCCGAGGGCAGACGGTGG - Intronic
1049847375 8:144809577-144809599 GACTGGCCGAGAGCCCTGGGAGG - Intronic
1060713073 9:125889909-125889931 GCGGGGCAGAGCGCCCTGAGCGG + Intronic
1061285469 9:129620188-129620210 GAGAGCGCGAGCGCCCCCGGAGG - Exonic
1061832234 9:133303516-133303538 AAGGGGCCGAGCTCGCTCAGAGG - Intergenic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1189733879 X:44049528-44049550 GAGGGGACCAGGGCCCTTGGAGG + Intergenic
1190745835 X:53321248-53321270 GAGGGCCCGGGGGCCCTAGGGGG + Exonic
1192818006 X:74614465-74614487 GAGGTGCGGAGCAGCCTCGGCGG - Exonic
1201283825 Y:12362636-12362658 GCAGGGCCGGGCTCCCTCGGGGG + Intergenic