ID: 1136540758

View in Genome Browser
Species Human (GRCh38)
Location 16:30926567-30926589
Sequence AGGGGGACGCAGGATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136540758_1136540771 23 Left 1136540758 16:30926567-30926589 CCAGCTGCATCCTGCGTCCCCCT 0: 1
1: 0
2: 4
3: 23
4: 306
Right 1136540771 16:30926613-30926635 TTCCTCCTGCCACTCTTTCCTGG 0: 1
1: 0
2: 4
3: 47
4: 473
1136540758_1136540773 27 Left 1136540758 16:30926567-30926589 CCAGCTGCATCCTGCGTCCCCCT 0: 1
1: 0
2: 4
3: 23
4: 306
Right 1136540773 16:30926617-30926639 TCCTGCCACTCTTTCCTGGTTGG 0: 1
1: 0
2: 2
3: 26
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136540758 Original CRISPR AGGGGGACGCAGGATGCAGC TGG (reversed) Intronic
900120090 1:1045174-1045196 AGGGGGCCACAGGCGGCAGCGGG - Exonic
900483621 1:2911048-2911070 AGGGGGACCCAGGACACACCAGG - Intergenic
900906528 1:5563584-5563606 AGTGGGCCGCTGGATGCAGAAGG - Intergenic
901065617 1:6492879-6492901 AGGGGGAGGCAGGCTGCACTAGG - Intronic
901295166 1:8155791-8155813 AGGGGGACGCAGGAGGCCGGTGG + Intergenic
902559938 1:17271025-17271047 AGAGGGGCTCAGGATGGAGCCGG - Intronic
902734588 1:18391816-18391838 AGGAGGACACAGGATGAAGACGG - Intergenic
903200946 1:21738427-21738449 AGGGGGGCGGAGGTTGCAGTGGG - Intronic
904008998 1:27379454-27379476 AGGGGAAAGGAGGATGCAGAGGG - Exonic
907903425 1:58762457-58762479 AAGGTGATGCAGGATGAAGCTGG + Intergenic
910770184 1:90823147-90823169 AGGAGGACACAGGATGAAGTAGG + Intergenic
911765103 1:101664874-101664896 GGGGTGACTCAGGATGGAGCAGG - Intergenic
921767062 1:218984032-218984054 AGGGGGACACCAGCTGCAGCAGG - Intergenic
922563670 1:226587292-226587314 AGGGGGATGGAGGAGGGAGCTGG + Intronic
923369402 1:233295508-233295530 CGGGGCGCGCAGGGTGCAGCGGG - Exonic
923412436 1:233723726-233723748 AGCTCGACGCAGAATGCAGCAGG - Intergenic
923629956 1:235643142-235643164 AGGCAGAAGCAGGAAGCAGCAGG - Intronic
923665284 1:235993489-235993511 AGAGGGAAGAAGGGTGCAGCAGG + Intronic
1062843577 10:689099-689121 GCGGGGACGCAGGATGCAGCGGG - Intronic
1063378289 10:5567299-5567321 AGGGAGACGGAGGTTGCAGTGGG + Intergenic
1064633392 10:17340267-17340289 AGGGTGACTCAGGACGAAGCAGG - Intronic
1064633404 10:17340324-17340346 GGGGTGACTCAGGATGGAGCAGG - Intronic
1066145009 10:32548371-32548393 AGGGTGACTCAGGACGGAGCAGG + Intronic
1066460535 10:35608541-35608563 AGGGGGCTGCAGGCTGCTGCAGG - Exonic
1067098773 10:43319737-43319759 AGGTGGATGCAGGAGCCAGCTGG + Intergenic
1069226046 10:65945648-65945670 AGGGAGATGCAGGATGGAACTGG + Intronic
1071718445 10:88120006-88120028 AGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1074161911 10:110842590-110842612 AGGGGGACTCAGGAATCAGCAGG - Intergenic
1074416241 10:113269346-113269368 AGGGGAAGGCAGGATTGAGCAGG + Intergenic
1074733640 10:116404182-116404204 AGGGGAACTCAGGTTGCAGATGG - Intergenic
1075603850 10:123790233-123790255 GGGGTGACTCAGGATGGAGCAGG + Intronic
1075603860 10:123790291-123790313 GGGGTGACTCAGGATGGAGCAGG + Intronic
1075603869 10:123790349-123790371 GGGGTGACTCAGGATGGAGCAGG + Intronic
1076821039 10:132939729-132939751 AGGGAGACGCAGCAGGCCGCTGG - Intronic
1077368139 11:2169519-2169541 AGGCCGGCACAGGATGCAGCAGG - Intronic
1077559743 11:3252176-3252198 GGGGTGACTCAGGATGAAGCAGG - Intergenic
1077565637 11:3297979-3298001 GGGGTGACTCAGGATGAAGCAGG - Intergenic
1082797037 11:57385653-57385675 AGGGGCACGAAGGAAGCTGCAGG - Intergenic
1083271180 11:61573347-61573369 AGGGGGTAGCCGGATGCAGGTGG - Intronic
1083655120 11:64225823-64225845 GGAGGGAGGCAGGAAGCAGCAGG - Exonic
1083842623 11:65313574-65313596 TGGGGGAGGCAGGATGCTGGGGG - Intergenic
1083862834 11:65433867-65433889 AGGGGGTGGCAGGAGGCGGCAGG - Intergenic
1084472141 11:69368770-69368792 AGGGGGAAGAGGGATGCAGGAGG - Intergenic
1084575755 11:69986868-69986890 AGGGGGCCGCAGTGTGCAGTGGG + Intergenic
1089094448 11:115907123-115907145 AGGGGGCAGGAGGAGGCAGCAGG - Intergenic
1089435322 11:118460360-118460382 TGGGGGACGGAGGTTGCAGTGGG - Intronic
1090437707 11:126700653-126700675 AGTGGGCCTCAGGAAGCAGCCGG + Intronic
1090988677 11:131796305-131796327 AGGAGCACGCAGGAGGCAGGAGG + Intronic
1091094110 11:132802390-132802412 AGGGTGATTCATGATGCAGCTGG - Intronic
1091602639 12:1927399-1927421 GGGGAGATGGAGGATGCAGCTGG + Intergenic
1092330690 12:7584225-7584247 GAGGTGACTCAGGATGCAGCAGG - Intergenic
1092330701 12:7584283-7584305 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1092330708 12:7584312-7584334 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1092890610 12:12965921-12965943 AGGGGGAGACAGGAAACAGCTGG + Intergenic
1092902843 12:13076070-13076092 AGGGGAACGCAGGATGCAGGAGG - Exonic
1093270720 12:17057492-17057514 AGGGGCACGCTGAATGAAGCTGG + Intergenic
1096179891 12:49544840-49544862 AGGGGAGAGCAGGATGCAGCGGG - Intronic
1096512963 12:52142007-52142029 ATGAGGACGCACGAGGCAGCCGG + Intergenic
1099368379 12:81798346-81798368 AGGGGGACGCAAGACGGAGCAGG + Intergenic
1100913408 12:99390789-99390811 AGGGGGCCTCAGCAGGCAGCTGG + Intronic
1102535224 12:113576087-113576109 AGGTGGACTTAGGATGGAGCAGG + Intergenic
1102642479 12:114379230-114379252 AAGGGGAAGCAGGAAGCACCAGG - Intronic
1104395210 12:128426682-128426704 AGGGGGACAGGGGATGTAGCAGG - Intronic
1104857923 12:131910480-131910502 AGGGGTTCGCATGGTGCAGCAGG + Intronic
1105020347 12:132812112-132812134 AGGGAGACGGAGGTTGCAGTGGG + Intronic
1105725690 13:23160261-23160283 AGGGGCGCGCCGGATCCAGCCGG + Intergenic
1105814293 13:24020106-24020128 AGGGAGAAGCTGTATGCAGCTGG - Intronic
1106911188 13:34465142-34465164 AGACAGACGCAGGAGGCAGCAGG + Intergenic
1112330611 13:98474549-98474571 GCGGGGACACAGGATGGAGCGGG - Intronic
1112955462 13:105052140-105052162 AGAGGGGCGCAGGAAGCAGCAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1116726159 14:48563610-48563632 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1116726166 14:48563639-48563661 AGGATGACTCAGGATGGAGCAGG - Intergenic
1116953631 14:50900803-50900825 AGAGGGAGGCAGGAAGCCGCCGG + Intronic
1119041891 14:71282017-71282039 AGAGGGAGGTAGGATGCAGGAGG - Intergenic
1119176768 14:72574325-72574347 AGGGGGCGGGAGGAGGCAGCAGG - Intergenic
1121873296 14:97428959-97428981 AGGGGCCCGCAGCATTCAGCAGG - Intergenic
1122125530 14:99576596-99576618 AGGGGCAGGCAGGATGCAAATGG + Intronic
1122382137 14:101315881-101315903 AGGGTGACTCAGGATGGATCAGG - Intergenic
1122889560 14:104726027-104726049 GGGAGCACGGAGGATGCAGCAGG + Intronic
1123410675 15:20056327-20056349 AGGAGGGCTCAGGATGCAGAAGG - Intergenic
1123520004 15:21063033-21063055 AGGAGGGCTCAGGATGCAGAAGG - Intergenic
1128527514 15:68422524-68422546 AGGGGGAGGCTGGATACAGCAGG - Intronic
1128720236 15:69942553-69942575 AGGGGTGTGCAGGAGGCAGCTGG + Intergenic
1129107965 15:73322234-73322256 AGGGGGAGGGAGGAGGGAGCAGG - Exonic
1129188251 15:73923355-73923377 TGGGGGAACCAGGAAGCAGCAGG - Intergenic
1129316993 15:74751040-74751062 AGGGGGTTGCAGCTTGCAGCAGG - Intronic
1129396118 15:75247984-75248006 GGAGGGAGCCAGGATGCAGCTGG + Intergenic
1130402038 15:83566303-83566325 AGGGGGATGTGGGATGCAGCAGG - Intronic
1131061672 15:89408402-89408424 AGGGGAACCCAGGGTACAGCTGG - Intergenic
1131613149 15:93986103-93986125 TGGGTTACGCAGGAAGCAGCTGG + Intergenic
1132222641 15:100116597-100116619 ATGGGGTTGCAGGATGCACCTGG + Intronic
1132276497 15:100569518-100569540 AAGGAGATTCAGGATGCAGCTGG - Exonic
1132504835 16:302595-302617 GGGTGGACGCAGGGTGCCGCTGG - Intronic
1132639621 16:971606-971628 AGGGGGACTCAGGACTCAGGAGG + Intronic
1133438952 16:5804630-5804652 AGGGGAAGGGAGGATGCAGCAGG - Intergenic
1133961162 16:10494848-10494870 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1136292682 16:29285319-29285341 ATGGGGGCGCCGGATGCTGCAGG - Intergenic
1136540758 16:30926567-30926589 AGGGGGACGCAGGATGCAGCTGG - Intronic
1137706572 16:50539685-50539707 AGGCAGACGCAGGCTGCTGCTGG - Intergenic
1141475755 16:84272080-84272102 AGAGGGATGAAGGATGAAGCTGG + Intergenic
1141625307 16:85258496-85258518 ACGGGGCCGCAGGATGCAAGAGG - Intergenic
1141858467 16:86700899-86700921 CGGGGGACGAGGGAAGCAGCTGG - Intergenic
1142113525 16:88344713-88344735 TGGTGGACCCAGGATGCAGCCGG + Intergenic
1142118899 16:88376389-88376411 AGGGGGAGGGAAGCTGCAGCAGG + Intergenic
1142259031 16:89033792-89033814 AGGGGGACTCAGGAGGTAGAAGG + Intergenic
1142654976 17:1385653-1385675 AGGAAGACGGAGGATGCAGGTGG + Intronic
1144620353 17:16814847-16814869 AGGGGGAGGGAGGATGAAACTGG - Intergenic
1145736452 17:27235543-27235565 AGGCTGAGGCAGGAGGCAGCAGG + Intergenic
1146646932 17:34581970-34581992 AGAGGGAAGGAGGCTGCAGCGGG + Intronic
1146906619 17:36622186-36622208 AGGAGGGGGCAGGAGGCAGCAGG - Intergenic
1147971673 17:44221555-44221577 AGCAGGAGGCAGGAGGCAGCGGG - Exonic
1147987429 17:44314700-44314722 AGAGGGCCAGAGGATGCAGCAGG - Intronic
1148108667 17:45132533-45132555 AGGGAGTCGGAGGAGGCAGCAGG + Intronic
1148795637 17:50195377-50195399 AGGGGCAGGCAGGCTGCAGGCGG + Intronic
1149635884 17:58168865-58168887 AGGAAGACACTGGATGCAGCTGG - Intergenic
1150245389 17:63670840-63670862 AGGGGAGGGCAGGATGAAGCTGG + Intronic
1151975349 17:77481084-77481106 AGGGGTACCCAGGATGGGGCTGG - Intronic
1152070368 17:78131189-78131211 AGGTGGATGCGGGGTGCAGCAGG + Intronic
1152195954 17:78918473-78918495 AGTGGCAGGCAGGATGAAGCTGG - Intronic
1152229865 17:79109124-79109146 AGGGAGATGCAGGATCCACCCGG - Intronic
1152484906 17:80584068-80584090 AGGGGGACCCAGCAGGGAGCTGG + Intronic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1154304267 18:13218665-13218687 GGGGGGACGCCGGGTGAAGCGGG - Intronic
1154337601 18:13477991-13478013 AGGGGGACGAAGGAGTCAGTGGG - Intronic
1155803607 18:30139774-30139796 GGGGTGACTCAGAATGCAGCAGG - Intergenic
1156668252 18:39434892-39434914 TGGGGGAAGGAGGGTGCAGCAGG + Intergenic
1157736316 18:50052972-50052994 AGGGGGAGGGAGGATGCACGAGG + Intronic
1159098778 18:63936553-63936575 TGGGGGTCGCAGGATGCCACGGG - Intergenic
1160084054 18:75757788-75757810 AGGGGGAAGGAGGATGGAACTGG + Intergenic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160363887 18:78308025-78308047 GCGTGGACCCAGGATGCAGCTGG + Intergenic
1160811540 19:1015025-1015047 AAGGTGAGGCAGGAAGCAGCAGG - Intronic
1163157152 19:15445785-15445807 CGGGGGACAGAGGAGGCAGCGGG + Intronic
1163959507 19:20675567-20675589 GGGGTGACTCAGGATACAGCAGG - Intronic
1164241990 19:23397462-23397484 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1164433369 19:28207608-28207630 AGGGGCACACATGCTGCAGCAGG + Intergenic
1164822389 19:31260213-31260235 AGGGGAACTCAGGATGCAGAGGG - Intergenic
1164898234 19:31896188-31896210 AGACGGAGGCAGGATGAAGCTGG - Intergenic
1165404243 19:35620048-35620070 TTGGGGACGCGGGGTGCAGCTGG - Exonic
1165845771 19:38816814-38816836 GGTGGGAGGCAGGATGGAGCCGG - Intronic
1166380106 19:42351253-42351275 AAGGGGACGCGGCATGCAGCCGG + Exonic
1166783037 19:45352190-45352212 AGGGGGACGCAGGCCTCACCCGG + Exonic
1167777931 19:51573443-51573465 GGGCAGACACAGGATGCAGCAGG + Intronic
1167941028 19:52946104-52946126 AGTGGGGCGCTGGTTGCAGCGGG - Intronic
1168003009 19:53463919-53463941 AGTGGGGCGCTGGTTGCAGCGGG + Intergenic
925380915 2:3425402-3425424 TGGGGGAAGCAGGATGTAACTGG - Intronic
925959816 2:9003909-9003931 AGGGGGCCGCTGGAAGCTGCTGG - Intergenic
926220229 2:10931334-10931356 ATGGGGACACAGGATTCTGCAGG + Intergenic
929711100 2:44267400-44267422 AGGGGGATGGAGGCTGGAGCTGG + Intergenic
930657554 2:54021248-54021270 TGGGTGACTCAGGATGGAGCAGG + Intronic
930667855 2:54116970-54116992 GGGGTGACTCAGGATGGAGCAGG + Intronic
930928101 2:56846323-56846345 GGGGTGACTCAGGATGGAGCAGG - Intergenic
932395883 2:71447602-71447624 AGGGGGACTCGGGAGGCAGGGGG - Intergenic
932557988 2:72842456-72842478 AGAGGGGAACAGGATGCAGCTGG - Intergenic
933028977 2:77301664-77301686 AGAGGAATGCAGGAGGCAGCTGG + Intronic
933846042 2:86328092-86328114 AGGGAGTTGCAGGATCCAGCAGG - Intronic
935753685 2:106260976-106260998 GGGAGGACGCAGGCTGCAGGAGG - Intergenic
935872595 2:107467769-107467791 AGGGAGACTCAGGAAGCAGTGGG - Intergenic
936032093 2:109080481-109080503 AGTGGGAACCAGGTTGCAGCTGG + Intergenic
938131729 2:128721812-128721834 AAAGGGACACAGGAGGCAGCTGG + Intergenic
938181637 2:129189895-129189917 AGGGGGACAGAGGGTGCAGGGGG + Intergenic
940637890 2:156320362-156320384 AGGAAGACGCAGGGAGCAGCTGG + Intergenic
945889061 2:215409318-215409340 AGGTAGGCGCATGATGCAGCTGG + Intronic
946477196 2:220018414-220018436 AGGGGGAGTCTGGAGGCAGCAGG - Intergenic
947347533 2:229208768-229208790 AGAGGGACGGAGGAGGCAGGAGG + Intronic
947506525 2:230712467-230712489 AGGGGGACACAGCATCCAGGGGG - Intergenic
947535792 2:230939861-230939883 AGGGGCAAGCAGGCTGCAGCGGG + Intronic
948259301 2:236591035-236591057 AGCAGGAGGCAGGAGGCAGCAGG - Intergenic
948332716 2:237182835-237182857 ATGGGGAAGCTGTATGCAGCTGG + Intergenic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
948606968 2:239141984-239142006 AGAGGGATGCAGGATGGCGCAGG + Intronic
948987615 2:241534886-241534908 GGGTCGACTCAGGATGCAGCGGG - Intergenic
1170401733 20:15992630-15992652 AGGGCGATACAGGATGTAGCCGG - Intronic
1170848927 20:19986254-19986276 AGAGGGACCCACGATCCAGCTGG - Intronic
1171388569 20:24786592-24786614 AAGGGGTCTCAGGAAGCAGCTGG - Intergenic
1172060535 20:32184294-32184316 AGGGGAATGCAGGATGCAGCTGG + Intergenic
1173571297 20:44078190-44078212 AGGGGGAAGCAAGATGGAGGAGG - Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1174057103 20:47805706-47805728 AATGGCACGCAGGATGCAGTGGG + Intergenic
1175220175 20:57412202-57412224 AGAGGCACGCAGGATCCAGAGGG + Intergenic
1175285995 20:57837217-57837239 AGGGGGACTAAGGCTGCAGATGG + Intergenic
1175720159 20:61280913-61280935 AGAGGAACGCAGCAGGCAGCGGG - Intronic
1178824506 21:36004724-36004746 AGGGGGACGGGGGAGGCAGTGGG + Intergenic
1179225052 21:39445694-39445716 AGGGGGACGACGGCAGCAGCGGG + Exonic
1179719440 21:43306910-43306932 AGGGGGTCTCAGGATACTGCTGG - Intergenic
1181885220 22:26016799-26016821 AGGGGGACACAGGAGGCTGTGGG + Intronic
1182037973 22:27214247-27214269 GAGGGGACGGAGGAGGCAGCCGG - Intergenic
1183243603 22:36676399-36676421 TGGCGTACCCAGGATGCAGCTGG + Intronic
1183294079 22:37019619-37019641 AGGGGGACGCCGGGTGGCGCGGG + Intronic
1183309668 22:37102676-37102698 TGGGGGACGGAGCAGGCAGCTGG - Intronic
1183349465 22:37326798-37326820 ATGGGGAGGCAGCAAGCAGCAGG - Intergenic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183784891 22:40023599-40023621 AGGGACACGCAGAAGGCAGCGGG - Intronic
1184244979 22:43231278-43231300 AGTGGGATCCAGGATGCAGCAGG - Intronic
1184412275 22:44332043-44332065 AGGAGGGCGCAGGACGCGGCGGG - Intergenic
1184789261 22:46689242-46689264 AGGGAGGGGCAGGAGGCAGCAGG - Intronic
1185021697 22:48380301-48380323 AGGGGGACCCAGGGTGCGGGAGG + Intergenic
949576480 3:5343411-5343433 AGGGGGAGGAAGGAGGGAGCAGG + Intergenic
950107344 3:10396671-10396693 TGGGGGAGGCAGGCTGCTGCAGG + Intronic
950594069 3:13963343-13963365 GGGGTGACTCAGGATGGAGCAGG + Intronic
950674982 3:14549362-14549384 ATAGGGAGGCAGGCTGCAGCTGG - Intergenic
952287213 3:31980954-31980976 AGGCGGCCGCAGGAGGGAGCCGG - Exonic
952671802 3:35977586-35977608 TGGGGGAAGCAGGATACAGCAGG + Intergenic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954580519 3:51700652-51700674 AGGGGGAGGCAGGCAGCAGAGGG - Intronic
955043092 3:55335693-55335715 TGAGGAAGGCAGGATGCAGCAGG - Intergenic
955818863 3:62875083-62875105 TGGGGGGCGCTGGAGGCAGCCGG + Exonic
959595987 3:108128909-108128931 AGAAGGAAGCAGGATGGAGCTGG + Intergenic
961718035 3:128872328-128872350 AGGGCCACACAGGAAGCAGCAGG + Intergenic
962275329 3:134008989-134009011 GGGTGGACCAAGGATGCAGCTGG - Intronic
965274456 3:166663302-166663324 GGGGTGACTCAGGATGGAGCAGG - Intergenic
965604563 3:170485515-170485537 AGGGGGATGTTGGATGCAGCTGG + Intronic
966866359 3:184260948-184260970 AGGGGGACACACACTGCAGCGGG + Intronic
968059467 3:195716213-195716235 GGGGTGACTCAGGATGGAGCAGG + Intergenic
970633394 4:17979788-17979810 AGGGGGAAACAGGCTGCAGATGG + Intronic
975116520 4:70687206-70687228 AGGGGGTCGGAGGTTGCAGTGGG + Intergenic
980593340 4:134920734-134920756 TGGGAGACGCAGGTTGCAGTGGG + Intergenic
983674011 4:170270859-170270881 GGGGCGACTCAGGATGGAGCAGG - Intergenic
984207883 4:176808461-176808483 GGGGTGACTCAGGATGGAGCAGG + Intergenic
984227064 4:177047669-177047691 AGGGGGATGCACTATGCATCAGG - Intergenic
985489415 5:170747-170769 AGGGGGGAAGAGGATGCAGCTGG - Intronic
985644562 5:1078860-1078882 AGCGGGCCGCAGGATCCAGGTGG + Intronic
986286072 5:6360085-6360107 AGGAGGAGGCAGGATGTGGCAGG + Intergenic
987006890 5:13719752-13719774 AGTGGGAGGCAGGAAGTAGCAGG - Intronic
987295847 5:16550602-16550624 AAGGGGAAGAAGCATGCAGCAGG - Intronic
988454316 5:31373641-31373663 AGGAGGAGGCAGGATGCAGCTGG - Intergenic
990553029 5:56903269-56903291 AGGGGGACAGAGGAAGTAGCAGG - Intergenic
990572995 5:57097649-57097671 AGGTTGACTCAGGATGGAGCAGG - Intergenic
990620110 5:57550194-57550216 AGAGGCACTCTGGATGCAGCCGG + Intergenic
996268746 5:121577024-121577046 AGGGAGATGCAGGCTGCAGTGGG + Intergenic
998400478 5:141846226-141846248 ATGGAGACGCACGGTGCAGCTGG + Intergenic
999287851 5:150404885-150404907 AGAGGGAACCAGGCTGCAGCTGG - Intronic
999586417 5:153094589-153094611 AGGGGAAAGAAGGAGGCAGCGGG + Intergenic
1001455415 5:171856439-171856461 AGTGGAACGCAGGATGCAATAGG + Intergenic
1003299542 6:4865127-4865149 GGGGTGACTCAAGATGCAGCAGG - Intronic
1004434950 6:15581866-15581888 AGGGGGACACAGTGTGCAGAGGG + Intronic
1004683450 6:17918795-17918817 AGGGCCAAGCAGGATGCAGGTGG - Intronic
1005817222 6:29563465-29563487 AGGGTGACTCCGGATGGAGCAGG + Intronic
1005856449 6:29866678-29866700 AGGGAGACCCAGGTTGCTGCTGG - Intergenic
1006030221 6:31172281-31172303 GGAGGGACGCACGATGAAGCTGG - Intronic
1008043534 6:46828436-46828458 AGTGTGAGGCAGGATGAAGCTGG + Intronic
1008837205 6:55848771-55848793 GGTGGGACAAAGGATGCAGCAGG + Intronic
1011482876 6:87812495-87812517 AGGGGGATGCAGGATGGCACAGG + Intergenic
1012672615 6:102074029-102074051 GGGGTGACACAGGATGGAGCAGG + Intergenic
1013370967 6:109470657-109470679 AGTGGGAGGCAGGATGCTGAGGG - Intronic
1013470516 6:110460165-110460187 AGGGAGCATCAGGATGCAGCGGG - Intronic
1014755851 6:125301658-125301680 CGGTGGACGGAGGAAGCAGCCGG - Intronic
1017864997 6:158435465-158435487 AGGAGGAGGCAAGATCCAGCTGG - Intronic
1018627311 6:165792301-165792323 AGCAGGACGCAGGCTGCAGAGGG + Intronic
1018635134 6:165854291-165854313 AGGGGCCCGCAGGAGGCAGGAGG + Intronic
1018867221 6:167755647-167755669 AGGGGCACGCAGGCAGAAGCGGG + Intergenic
1018990380 6:168669245-168669267 AGGGGGACGCAGGATGTTGTGGG - Intronic
1019136756 6:169913513-169913535 AGGGAGGGGCAGGAAGCAGCTGG + Intergenic
1019192321 6:170259461-170259483 AGGATGACGCAGGCTGCAGATGG + Intergenic
1019733980 7:2641445-2641467 AGGGGGACTGAGGCTGCAGGAGG + Intronic
1019913010 7:4112997-4113019 AGGCTGAGGCAGGAGGCAGCGGG - Intronic
1019966164 7:4500352-4500374 GGGGTGACTCAGGATGGAGCAGG + Intergenic
1020268482 7:6577649-6577671 AGGGGGACGTGGAGTGCAGCAGG - Exonic
1020743776 7:12055439-12055461 AGGGGGAAGCAGTATTCAGCAGG - Intergenic
1022853868 7:34296483-34296505 AGTGGGAGACAGGATGCAGGAGG - Intergenic
1023000230 7:35801034-35801056 CGGGGGACGGAGGAGGGAGCGGG + Exonic
1024232297 7:47371835-47371857 GGGTGGACTCAGGATGGAGCTGG - Intronic
1024367496 7:48537720-48537742 AGGGTGACTCAGGTTGCAGCAGG + Intronic
1024509304 7:50190613-50190635 TGTGGGAGCCAGGATGCAGCAGG - Intergenic
1024582250 7:50809700-50809722 GGAGGGACAGAGGATGCAGCTGG - Intergenic
1024642531 7:51341940-51341962 AGGTGGGCGCTGGAAGCAGCAGG - Intergenic
1025211250 7:57020553-57020575 AGTGGGGGGCGGGATGCAGCTGG - Intergenic
1025660704 7:63556294-63556316 AGTGGGGGGCGGGATGCAGCTGG + Intergenic
1026593074 7:71712897-71712919 AGGGCCCCGCAGGATGGAGCTGG + Exonic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027046344 7:74993916-74993938 AGGGGGAAGGAGGGTGCAGCAGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1029386635 7:100247692-100247714 AGGGGGAAGGAGGGTGCAGCAGG + Intronic
1030102223 7:105956533-105956555 AGGGGGAAGAAGGAATCAGCTGG + Intronic
1031552461 7:123132081-123132103 AGGGGCACTTAGTATGCAGCTGG + Intronic
1031972833 7:128076413-128076435 AGAGGGACCCAGGAGGCGGCAGG - Intronic
1033808274 7:144979038-144979060 AGGGGTAGGCAGGAGGGAGCTGG + Intergenic
1034319105 7:150163078-150163100 AGGGAGGCGGAGGTTGCAGCAGG + Intergenic
1035403923 7:158586765-158586787 CGGGGGACGCAGGTAGAAGCGGG + Intronic
1037804867 8:22053592-22053614 TGGGGGAGGGAGGAGGCAGCAGG + Intronic
1039467980 8:37797277-37797299 CGGGGGACGCAGGATGCGGGGGG + Exonic
1039948981 8:42153170-42153192 GCGGGGTCTCAGGATGCAGCCGG + Intronic
1040596793 8:48846445-48846467 TGAGGGATGCAGGATGCTGCGGG - Intergenic
1041552586 8:59118739-59118761 AAGCGCACGCAGGCTGCAGCGGG + Intronic
1043448690 8:80344396-80344418 AGGGAGACGGAGGTTGCAGTGGG - Intergenic
1045242108 8:100411628-100411650 AGAGGGACAGAGGATGCAGTAGG + Intergenic
1047575017 8:126143313-126143335 GGGGTGACTCAGGATGGAGCAGG + Intergenic
1047575024 8:126143342-126143364 GGGGTGACTCAGGATGGAGCAGG + Intergenic
1049024576 8:139979801-139979823 AGGGGGACCCAGGACAGAGCTGG + Intronic
1049544930 8:143226140-143226162 GGGGAGGCGCAGGATGCAGGGGG - Intergenic
1053569418 9:39288461-39288483 AGAGGGACGGAGGAAGCTGCCGG - Intergenic
1053835379 9:42129482-42129504 AGAGGGACGGAGGAAGCTGCCGG - Exonic
1054091047 9:60847445-60847467 AGAGGGACGGAGGAAGCTGCCGG - Intergenic
1054112458 9:61123001-61123023 AGAGGGACGGAGGAAGCTGCCGG - Intergenic
1054127728 9:61330549-61330571 AGAGGGACGGAGGAAGCTGCAGG + Intergenic
1054595247 9:67059128-67059150 AGAGGGACGGAGGAAGCTGCCGG + Intergenic
1054946862 9:70804981-70805003 AGTGGGACCCTGGCTGCAGCTGG - Intronic
1055340796 9:75280742-75280764 AGAGGGAGGCAGGATGAGGCTGG - Intergenic
1055771098 9:79717847-79717869 AGTGGCAGGCAGGAGGCAGCTGG - Intronic
1056561669 9:87735241-87735263 AGGCTGAAGCAGGCTGCAGCTGG - Intergenic
1057318236 9:93986402-93986424 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1057564993 9:96159855-96159877 ATGGGAAAGCAGGATACAGCAGG + Intergenic
1057977058 9:99616921-99616943 AGGGAGCAGAAGGATGCAGCAGG + Intergenic
1058575531 9:106396856-106396878 AGAGGGACTCAGGCTGAAGCAGG + Intergenic
1060804097 9:126564051-126564073 TGGGGCACGCAGCAGGCAGCAGG + Intergenic
1060936915 9:127521454-127521476 TGGGGGTGGCAGGAGGCAGCTGG - Intronic
1061242264 9:129381610-129381632 AGGGGCATGCAGGCTGCAGAGGG - Intergenic
1061450438 9:130664496-130664518 AGGAGGACGCAGGAGGGAGCGGG - Intergenic
1061958073 9:133973935-133973957 ACGTGGAAGCAGGATCCAGCAGG + Intronic
1062036100 9:134383262-134383284 AGGGTGAGGCAGGATGGAGGTGG + Intronic
1062142934 9:134969781-134969803 TGGGGGACCCAGGATGCAGGGGG - Intergenic
1062179141 9:135181320-135181342 TGGGGCACGCAGCCTGCAGCAGG - Intergenic
1062473019 9:136714486-136714508 AGGAGGAGGGAGGCTGCAGCTGG - Intronic
1062480592 9:136749111-136749133 GAGGGGAGGCAGGAGGCAGCAGG - Intergenic
1062523753 9:136970083-136970105 AGGAGGAAGGAGGGTGCAGCTGG + Intronic
1062657468 9:137611738-137611760 AGGGGTAGGCAGGATGCATGTGG + Intronic
1062716105 9:138011008-138011030 AGGGAGGCTCAGGCTGCAGCTGG - Intronic
1062716249 9:138011649-138011671 GGTGGGAAGCTGGATGCAGCCGG + Intronic
1186493868 X:9996550-9996572 AGGGTGAGGCAGGAGGCAGGGGG - Intergenic
1186917090 X:14234453-14234475 AGGAGGAGGCTGGATGCAGTGGG - Intergenic
1188688666 X:33101555-33101577 AGGGAGGCGGAGGTTGCAGCGGG + Intronic
1188898730 X:35701581-35701603 AGCAGGACGAAGGAAGCAGCTGG + Intergenic
1189722261 X:43932512-43932534 AGGGGGATGAAGGCTGCAGATGG + Intergenic
1194103595 X:89738632-89738654 AGGTGGAGGCAGGATTAAGCAGG + Intergenic
1195235040 X:102888724-102888746 AGGGGGTGGTAGGATGGAGCTGG + Intergenic
1196100620 X:111843710-111843732 AGTGGGAGCCAGGATGCAACAGG + Intronic
1196870635 X:120110031-120110053 AGGAGGGAGCAGGAGGCAGCTGG - Intronic
1197704302 X:129622910-129622932 AGGAGGAAGCCGGAAGCAGCTGG - Intergenic
1197934324 X:131725197-131725219 GGGGTGACTCAGGATGGAGCAGG - Intergenic
1198117047 X:133554554-133554576 AGGGTGAGTCAGGATGGAGCAGG - Intronic
1199821006 X:151446425-151446447 AGGGGGATGAAGGTTGCAGATGG + Intergenic
1200309256 X:155060754-155060776 AGGAGGAGGCAGCATGCAACAGG - Intergenic