ID: 1136541745

View in Genome Browser
Species Human (GRCh38)
Location 16:30931158-30931180
Sequence CATTTCTAATAGAGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136541745 Original CRISPR CATTTCTAATAGAGGCTGGG GGG (reversed) Intronic
900734713 1:4291303-4291325 CATTTCTGAAAGATTCTGGGGGG + Intergenic
901001186 1:6149505-6149527 GATGTCTAATAGAGGGTGGATGG + Intronic
901263660 1:7892652-7892674 TATTTTTAGTAGAGGCGGGGAGG + Intergenic
902260027 1:15218009-15218031 CATTCCTAAAGGAGGGTGGGAGG + Intronic
903436364 1:23352908-23352930 AATATCCATTAGAGGCTGGGTGG + Intergenic
903446945 1:23428570-23428592 CATCTCTAATAAAGGATTGGGGG - Exonic
904790740 1:33018746-33018768 GATTTCTAACTGAGGTTGGGTGG - Intronic
906851133 1:49251379-49251401 CATTGCAAATGGAGGCTTGGTGG + Intronic
913393783 1:118343680-118343702 TTTTTCTAATAAAGGCTGGCAGG + Intergenic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914806537 1:150996092-150996114 CATTTCTAATATAGCCTGCAGGG - Intronic
915075693 1:153306714-153306736 CATTTCTCAGAGTAGCTGGGAGG + Intronic
916096061 1:161351461-161351483 AATTCCTAATACAGGCTTGGTGG + Intronic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
917691777 1:177477251-177477273 CATTTCTGATAGTGGCAGAGGGG - Intergenic
917853431 1:179083566-179083588 TATTTTTAGTAGAGGCGGGGGGG + Intronic
918427727 1:184427388-184427410 GATTTCTCAGAGAGGCTTGGAGG + Intronic
919360852 1:196592334-196592356 AATGTTTAATAGAGGCTGGGAGG + Intronic
919539263 1:198828477-198828499 CTTTTATAATAGAGACAGGGAGG - Intergenic
919703052 1:200651414-200651436 CCCTTCTAAAAGAGGCTGGATGG + Intronic
922236565 1:223726762-223726784 CATTTGTATCAGGGGCTGGGAGG - Intronic
922916706 1:229263812-229263834 TATTTTTAGTAGAGGTTGGGGGG + Intergenic
923408077 1:233682757-233682779 CATTGCTATGAGAGCCTGGGAGG + Intergenic
924669448 1:246108564-246108586 CATTTATAATAGACGGTGGAGGG - Intronic
1067197758 10:44137195-44137217 CATTATTAATACAGGTTGGGAGG + Intergenic
1068704723 10:60061971-60061993 AATTCATTATAGAGGCTGGGTGG + Intronic
1069855551 10:71439067-71439089 TATTTCTAAGGGTGGCTGGGAGG - Intronic
1070585601 10:77763644-77763666 CATTTCTAATATAGGGCTGGAGG + Intergenic
1072788707 10:98302200-98302222 GATTTGAAATAGAGGCTTGGAGG + Intergenic
1074672103 10:115803081-115803103 CATTTCTAGTACTGGCTGTGTGG - Intronic
1074699606 10:116081496-116081518 CATTTATAATGGGGGCAGGGAGG + Intronic
1075252067 10:120888429-120888451 CAGTTCTAATAGATGCTCAGAGG - Intronic
1076145145 10:128112865-128112887 CCTTTGTAATAGGGCCTGGGCGG - Intronic
1081330402 11:41793524-41793546 CTTTTATAATAGAGACAGGGAGG + Intergenic
1084020852 11:66416979-66417001 CTTCTCTGATAAAGGCTGGGGGG + Intergenic
1087461564 11:98454365-98454387 CTTTTATAATAGAGACGGGGAGG - Intergenic
1088898048 11:114092668-114092690 CATCTCTAAAATGGGCTGGGAGG + Intronic
1089899893 11:121970054-121970076 CATTTCTTATAGAGGGAGAGGGG - Intergenic
1095693176 12:45113958-45113980 TATTTTTAGTAGAGACTGGGGGG - Intergenic
1097845042 12:64357723-64357745 CATTTTTAGTAGAGATTGGGGGG - Intronic
1101162170 12:101989434-101989456 CAGTTCTAATAGAGATTTGGTGG + Intronic
1101455618 12:104827316-104827338 CTTTTATAATAGAGACAGGGAGG + Intronic
1101940303 12:109094887-109094909 CATTTCTCATAGAGGCTGAGAGG - Intergenic
1101960860 12:109248842-109248864 AATCTCTAACAGAGGCTGGCGGG + Intronic
1102039990 12:109794483-109794505 CGGTTCTAAGAGAGGCAGGGTGG + Exonic
1104723487 12:131060266-131060288 CTTTGCTCATAGAGGCTGGGTGG + Intronic
1105816823 13:24043819-24043841 CATTTCCAATAGAGTCAGGAAGG - Intronic
1105992406 13:25635741-25635763 CATTTCTGATAGGGGATGTGAGG - Intronic
1110604097 13:77410912-77410934 CATTTGTAAAAGAGACTTGGGGG - Intergenic
1111292617 13:86187823-86187845 CTTTTATAATAGAGACAGGGAGG + Intergenic
1115863173 14:37712341-37712363 TATTTCTAAGATAGGTTGGGAGG - Intronic
1116077275 14:40126948-40126970 CTTTTCTAATGGAACCTGGGTGG + Intergenic
1116824282 14:49656935-49656957 CATTTTTAATAGAGATGGGGTGG - Intronic
1117579158 14:57134457-57134479 CATTTCTAATAAATAATGGGAGG - Intergenic
1118152010 14:63199696-63199718 CAGATTTGATAGAGGCTGGGAGG - Intergenic
1118462321 14:65998517-65998539 CATTGCTAATAATGACTGGGAGG - Intronic
1122642273 14:103166967-103166989 CATTTATAATAGAGACAGGGAGG + Intergenic
1122768781 14:104087845-104087867 CATTTCTGAAAGAGGCTGTGAGG + Intronic
1124613008 15:31221952-31221974 CATTTCTAAGAGAGGGTGAAGGG + Intergenic
1126042159 15:44601881-44601903 CATTGGTGAAAGAGGCTGGGTGG - Intronic
1127067512 15:55256091-55256113 CAAGTCAAGTAGAGGCTGGGAGG + Intronic
1127232393 15:57011166-57011188 CATTTCAAATAGAGGTTTGGAGG - Intronic
1131593619 15:93774399-93774421 AATTTCTAATAGAGGCAGGAGGG - Intergenic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1137022362 16:35441286-35441308 CATTTCTACTATAGCCTGAGAGG + Intergenic
1142587220 17:980804-980826 TATTTTTAGTAGAGGCGGGGGGG - Intergenic
1143835152 17:9685971-9685993 TGGTTCTACTAGAGGCTGGGAGG - Intronic
1144301360 17:13925152-13925174 CTTTTATAATAGAGACAGGGAGG + Intergenic
1146457870 17:33021168-33021190 CACATCTCATAGAGGGTGGGAGG - Intronic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147290556 17:39438771-39438793 TATTTTTAATAGAGACTAGGTGG - Intronic
1148022845 17:44565047-44565069 CTTTTATAATAGAGACTGGGAGG - Intergenic
1150898332 17:69239693-69239715 CCTGACTAATAGAGGCCGGGTGG - Intronic
1151001447 17:70381528-70381550 CACTGCTAATAGAGGCCAGGTGG - Intergenic
1153035057 18:754017-754039 CATTTCTCACAGGGACTGGGTGG + Intronic
1155810214 18:30223570-30223592 AATTGCTTATAGAGGCTGCGGGG - Intergenic
1156758376 18:40556647-40556669 AATTTGTAACAGAGGCAGGGCGG - Intergenic
1157880721 18:51318762-51318784 TATTTTTAGTAGAGACTGGGGGG + Intergenic
1159142397 18:64413546-64413568 CATTTTTAGTAGAGACTGAGGGG - Intergenic
1160429513 18:78801768-78801790 CATTGCCAAGGGAGGCTGGGAGG + Intergenic
1163279424 19:16306535-16306557 TATTTTTAGTAGAGGCGGGGCGG - Intergenic
1163763982 19:19152248-19152270 CATTTTTAATAGAGATGGGGTGG - Intronic
1164519771 19:28970011-28970033 CATTTCTAATACATGCTTTGTGG - Intergenic
1164519820 19:28970420-28970442 CATTTCTAATGGAAACTGGAGGG - Intergenic
1164932830 19:32188473-32188495 CATTTTTAATAGATGCTTGGTGG + Intergenic
1167415570 19:49369673-49369695 CCTTTCTCAGAGTGGCTGGGCGG - Intronic
1167804898 19:51774345-51774367 CATTTCTAATAGGTGTAGGGTGG + Intronic
926120091 2:10237121-10237143 CTTTTCTAAGAGTGGCAGGGAGG + Intergenic
929037070 2:37704067-37704089 CATTTCTAATTGAGCTTGTGTGG + Intronic
932606931 2:73171718-73171740 CATTTCCAAGGGAAGCTGGGTGG - Intergenic
933388533 2:81642090-81642112 CAGTTCTAATAGATTTTGGGTGG - Intergenic
933925497 2:87088693-87088715 CATTTCCAAGGGAAGCTGGGTGG + Intergenic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG + Intronic
938804596 2:134794495-134794517 CTGTTCCAACAGAGGCTGGGAGG + Intergenic
939857512 2:147377929-147377951 AATATATAATAGAAGCTGGGCGG + Intergenic
941868580 2:170360143-170360165 CATTTCTGTTAGAGGATGGCTGG + Intronic
942303783 2:174586777-174586799 CATTTCTAACAGCTTCTGGGTGG - Intronic
942705974 2:178772937-178772959 CATTTGTAATTTAGGCTGGTGGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
944714233 2:202362688-202362710 CATCTTAAATAGGGGCTGGGTGG - Intergenic
944888490 2:204090312-204090334 CATATCTAAGAATGGCTGGGAGG + Intergenic
946846115 2:223860444-223860466 TATTTTTAGTAGAGGCGGGGCGG - Intronic
1170865633 20:20153502-20153524 CATTTCTAATTGAGGCTATTTGG - Intronic
1172265021 20:33604032-33604054 CATTTTTGATGGAAGCTGGGTGG - Intronic
1172442444 20:34975663-34975685 AATTCCTAATAGGGTCTGGGCGG + Intronic
1175476267 20:59276892-59276914 CATTTCTCATAGTGGGCGGGGGG - Intergenic
1182330574 22:29548830-29548852 CATGTCTAATACAGGCTTGTTGG + Intronic
1182791309 22:32955356-32955378 CATTTCAGATAGGGGGTGGGGGG + Intronic
1183754187 22:39743960-39743982 CATTTCTAGTAGTCACTGGGGGG - Exonic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949832937 3:8235968-8235990 TATTTTTAGTAGAGGCGGGGTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
952423632 3:33153060-33153082 GGTTTCTACTGGAGGCTGGGTGG + Exonic
955399582 3:58581841-58581863 CATGTCTAATTGCAGCTGGGTGG - Intronic
957590113 3:82185881-82185903 CATTTCCACAAGAGGCTGGGTGG - Intergenic
958632742 3:96702796-96702818 CTTTTATAATAGAGACAGGGAGG + Intergenic
960221318 3:115112470-115112492 GATAGATAATAGAGGCTGGGAGG - Intronic
960467734 3:118018234-118018256 CATTTCCACTGGTGGCTGGGTGG - Intergenic
963698900 3:148599446-148599468 CATTTATAATATGTGCTGGGAGG - Intergenic
967097722 3:186191210-186191232 CTTTTCTAATAGAGGTTGTAGGG - Intronic
967111156 3:186295208-186295230 CATTTAAAATATAGGCTGGGCGG + Intronic
968160325 3:196421598-196421620 TATTTTTACTAGAGACTGGGGGG - Intronic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
974267097 4:59599265-59599287 CATTTCTTGTAGAGTCTGGCTGG - Intergenic
975358347 4:73435009-73435031 CATTTTTTTTAGAGGGTGGGAGG + Intronic
976839542 4:89415216-89415238 GATTTGTGATAGATGCTGGGAGG + Intergenic
977404062 4:96574043-96574065 CAATTCAAACAGAGGCTGGCAGG + Intergenic
979769731 4:124508045-124508067 CATTTCTAGTGGTGGGTGGGGGG - Intergenic
982839571 4:160166879-160166901 CAGTTCTAATATAGGCTATGTGG - Intergenic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
992893707 5:81228515-81228537 CATTTCTAAGAGGAGATGGGAGG + Exonic
994210226 5:97079582-97079604 CTGTTCTACTAGAGGCAGGGTGG + Intergenic
994774639 5:104026800-104026822 CGTTTATAATAGAGACAGGGAGG + Intergenic
995097764 5:108259544-108259566 CATTTCTAACTGAGGCTGTGTGG - Intronic
996960798 5:129246763-129246785 CATTCCTTATAGAGGCTCTGAGG - Intergenic
997552261 5:134763537-134763559 CATTTGTTACAGAGGCTTGGAGG - Intronic
1000052102 5:157572261-157572283 TATTTTTACTAGAGACTGGGAGG + Intronic
1000104119 5:158042566-158042588 CATTTCCAGTAGTGGATGGGTGG + Intergenic
1002558408 5:180062359-180062381 CCCTTATAAAAGAGGCTGGGGGG - Intronic
1006459230 6:34148730-34148752 CAATGCTCAGAGAGGCTGGGGGG - Intronic
1006955615 6:37868401-37868423 CATTTGTGATAGAGGGAGGGAGG + Intronic
1010388069 6:75305226-75305248 CATTTATATTGGAGGCTGGAGGG - Intronic
1013165599 6:107588852-107588874 CATTTCTAACAGTGACTGGAAGG - Intronic
1013207625 6:107958633-107958655 CATTTAGAATAGGGGGTGGGAGG + Intergenic
1015909762 6:138159008-138159030 TATTTTTAGTAGAGGCAGGGGGG + Intergenic
1019770453 7:2880967-2880989 CATCTCTGAAAGAGGGTGGGAGG + Intergenic
1023752686 7:43387006-43387028 TATTTCAAATAGAGTCTGGATGG + Intronic
1026067724 7:67089856-67089878 CATTTTGAATAGACGCTGAGTGG - Intronic
1029089619 7:98038079-98038101 TATTTTTAATAGAGACGGGGTGG - Intergenic
1029986650 7:104928917-104928939 CATTTATAAAAGAAGTTGGGGGG - Intergenic
1030168801 7:106581007-106581029 CATTTGTATGAGAGTCTGGGTGG + Intergenic
1033269782 7:139920378-139920400 CATTTCTAAAAGAGGCAGGAAGG - Intronic
1033870685 7:145750822-145750844 CTTTTATAATAGAGACAGGGAGG - Intergenic
1034110746 7:148535506-148535528 CATTTCTGCCAGAGCCTGGGGGG + Intergenic
1034505423 7:151485836-151485858 CTTTTCTAATACAAGCAGGGGGG + Intronic
1035119975 7:156559006-156559028 CATTTCTAACAGAGGGGTGGGGG + Intergenic
1037718346 8:21419031-21419053 CATTCCAAAAAGCGGCTGGGAGG + Intergenic
1037928747 8:22865200-22865222 CATTTCTGAAACAGCCTGGGGGG + Intronic
1038142264 8:24858868-24858890 AACTTCCAATAGAGGCTGGAAGG - Intergenic
1039073852 8:33670993-33671015 TATTTCTTATGGAGGCTGTGGGG - Intergenic
1039620142 8:38989475-38989497 CATTTTTACTAGAGACTGGGCGG + Exonic
1039659978 8:39450689-39450711 CTTTTATAATAGAGACAGGGAGG + Intergenic
1042127142 8:65549618-65549640 CATTTGTCACAGAGTCTGGGTGG - Intergenic
1042604322 8:70530473-70530495 CTTTTGTAAGAGATGCTGGGTGG + Intergenic
1046101428 8:109618696-109618718 CATTTTTAAAGGAGGCAGGGTGG - Intronic
1046444499 8:114299205-114299227 TATTTTTAATAGAGACAGGGTGG + Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1048985865 8:139734524-139734546 CATTTCTAAGAGAGGCTGATAGG + Intronic
1052734507 9:32326772-32326794 CATTCATAATCGAGGCTAGGAGG - Intergenic
1054912573 9:70467414-70467436 TATTACTCATAAAGGCTGGGTGG - Intergenic
1056257901 9:84819113-84819135 CATTTCTAAAAGAGAGAGGGAGG - Intronic
1057927896 9:99169311-99169333 CATTTCTGAGAGAGGCAGGCAGG + Intergenic
1059059715 9:111022448-111022470 CAGTTTTAAAAGAGGGTGGGGGG + Intronic
1059360533 9:113738708-113738730 CATTTCTAACAGGCCCTGGGTGG + Intergenic
1062598335 9:137309071-137309093 CAGTTCTAATGGCGGCGGGGCGG + Intronic
1203564919 Un_KI270744v1:82010-82032 CATCTCTGAGAGTGGCTGGGTGG - Intergenic
1190373691 X:49767225-49767247 CATTCCTAATGGGGGCTGAGGGG + Intergenic
1190396159 X:49987370-49987392 CATTTCTCATAGAAGGTGGATGG + Intronic
1192888328 X:75361672-75361694 CATCTTGAATAGGGGCTGGGTGG + Intergenic
1192912929 X:75624343-75624365 CATTTCAAATAAAGATTGGGTGG + Intergenic
1193033015 X:76920231-76920253 TATTTCTAATACAGGCAGTGGGG - Intergenic
1199142771 X:144332379-144332401 CTTTTATAATAGAGACAGGGAGG - Intergenic
1200417686 Y:2930090-2930112 CGTATCAAATAGAGGCTGAGAGG + Intronic
1200842574 Y:7798112-7798134 CATTTCAGACAGAGGCTAGGTGG + Intergenic
1200922626 Y:8626853-8626875 CATTTCGGAAAGAGGCTGTGTGG - Intergenic
1200936399 Y:8742134-8742156 CCTTTCCAAAAGAGGCTGTGTGG + Intergenic
1202243630 Y:22794454-22794476 CATTTCCTATAAATGCTGGGTGG - Intergenic
1202396617 Y:24428204-24428226 CATTTCCTATAAATGCTGGGTGG - Intergenic
1202474166 Y:25241888-25241910 CATTTCCTATAAATGCTGGGTGG + Intergenic