ID: 1136544632

View in Genome Browser
Species Human (GRCh38)
Location 16:30948438-30948460
Sequence CCTTCCTCGAGCGCGGGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136544620_1136544632 -9 Left 1136544620 16:30948424-30948446 CCTCCTTCCCTGCCCCTTCCTCG 0: 1
1: 0
2: 8
3: 214
4: 1744
Right 1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 79
1136544616_1136544632 22 Left 1136544616 16:30948393-30948415 CCATGGGAACCTAGTAACAGACT 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 79
1136544619_1136544632 -8 Left 1136544619 16:30948423-30948445 CCCTCCTTCCCTGCCCCTTCCTC 0: 1
1: 4
2: 93
3: 752
4: 4746
Right 1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 79
1136544618_1136544632 13 Left 1136544618 16:30948402-30948424 CCTAGTAACAGACTCTGCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136544632 Original CRISPR CCTTCCTCGAGCGCGGGGTG GGG Exonic
903155665 1:21440666-21440688 CCGGCCTCGAGGGTGGGGTGCGG - Intronic
918343787 1:183589036-183589058 CCTTCCTCCAGCCAGAGGTGGGG + Intronic
920184619 1:204152149-204152171 GCTACCTGGAGCGCGGGGTGGGG + Intergenic
922769918 1:228176162-228176184 CCCTCCAGGAGCGTGGGGTGGGG + Exonic
1067713634 10:48670800-48670822 CCCTCCACCAGCGGGGGGTGGGG + Intergenic
1077038673 11:507620-507642 CCTTGCTGGGGCGCGGGGCGCGG + Intergenic
1086189117 11:84057123-84057145 TCTTCCTTGAGCCCGGAGTGGGG - Intronic
1089732429 11:120527505-120527527 CCTTCCTGGAGCCCGTGCTGGGG + Intronic
1096231740 12:49900577-49900599 CCTTCCCCGAGCCCGTGCTGGGG - Intronic
1097167755 12:57094653-57094675 CCCTCCACCAGCGCGGGATGGGG - Exonic
1105962669 13:25356182-25356204 CCTTCCTGGAGCCCAGAGTGGGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107666970 13:42700415-42700437 CCTTCCTCATGCTGGGGGTGGGG - Intergenic
1108962246 13:56248216-56248238 CCTGCCTAGAGCTAGGGGTGTGG + Intergenic
1116975817 14:51114557-51114579 GCTTCCTGGGGCGGGGGGTGGGG + Intergenic
1118619264 14:67599986-67600008 CCTCCTTCGAGCGCGGGGAGGGG + Intronic
1119296553 14:73537804-73537826 ACTTCCTCCCGCCCGGGGTGCGG + Exonic
1119300795 14:73569809-73569831 ACTTCCTCCCGCCCGGGGTGCGG + Exonic
1121365324 14:93303833-93303855 CCTTCCTCTGGTGGGGGGTGGGG - Intronic
1122863236 14:104591854-104591876 CCCTCATCGAGCCCCGGGTGGGG + Intronic
1123004829 14:105316116-105316138 CCCTCCTGGAGCGCAGGGTTGGG + Intronic
1123030828 14:105450308-105450330 CCTACCTGGAGCGGGAGGTGAGG + Exonic
1126172184 15:45704353-45704375 CGTTCCTGGAGCCCGGGCTGCGG + Intergenic
1129169547 15:73799279-73799301 CCTTCCTGGAGAGCAGGCTGAGG + Intergenic
1129313320 15:74726624-74726646 CCAGCCTCGCGCGCGGCGTGGGG + Intergenic
1131692778 15:94844989-94845011 CCTTCCCCGAGCGCGGCGGGAGG + Intergenic
1132719853 16:1310095-1310117 CCTTCCTCCTGCGCGGGGAGCGG + Intronic
1133972589 16:10578545-10578567 CCCTCCTCCAGCCCGAGGTGGGG + Intronic
1136026213 16:27470645-27470667 CCCTCCTGGAGCGCCAGGTGAGG - Intronic
1136389056 16:29950854-29950876 GCTTCCTGGAGCTAGGGGTGGGG + Intronic
1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG + Exonic
1139355825 16:66366625-66366647 CCTCCCTCGCCAGCGGGGTGTGG + Exonic
1142045791 16:87924498-87924520 CCTTCCTGGAGCCCGGGGAGAGG - Intronic
1142847907 17:2691001-2691023 CCTCCCTCCAGCGCAGGGGGAGG + Intronic
1144735494 17:17553227-17553249 CCCTCCTGGAGGGTGGGGTGGGG - Intronic
1146935335 17:36809297-36809319 CCTCCCTAGAGCTTGGGGTGAGG + Intergenic
1148618799 17:49019076-49019098 CCTCCCTCTAGGGAGGGGTGAGG + Intronic
1151976731 17:77487679-77487701 CCTTCCTGGAGCACAGAGTGGGG + Intronic
1152203398 17:78960204-78960226 CCTTCCTGGAAGTCGGGGTGGGG + Intergenic
1152834582 17:82520541-82520563 CCTTCCTGGAGCCGGGGCTGCGG + Intronic
1153001964 18:463971-463993 CCTTCCTGGAGCTCGGGCTGGGG - Intronic
1153997329 18:10454224-10454246 CTTTCCTTGCGGGCGGGGTGCGG + Intergenic
1160529559 18:79555511-79555533 CCTTCCTCATCCGCGGGGTCAGG + Intergenic
1160957095 19:1698815-1698837 CCTTCCTGGAGGGTGGGGAGGGG - Intergenic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1162744567 19:12791368-12791390 CCCTCCTCGAGCGTGGGGAAGGG - Intronic
1163441440 19:17324283-17324305 CCTTCCTCGAGGTGGGGCTGGGG - Intronic
1164575913 19:29405151-29405173 TCTCCCTCGAGCGCTGGGAGGGG + Intergenic
1167696719 19:51019431-51019453 CCTCCTTCACGCGCGGGGTGGGG + Intronic
926251237 2:11156520-11156542 CCTTCCTGGTGGGCGGGGTGGGG + Intronic
926315505 2:11706770-11706792 CCCTCTTGGAGCGTGGGGTGAGG + Intronic
926684868 2:15690841-15690863 CGTTCCTCAAACGCGAGGTGGGG - Intronic
928129689 2:28640821-28640843 CCTCCCTCGGGAACGGGGTGGGG - Intronic
937083922 2:119158393-119158415 CGGTCCCCGAGCGCGGGGAGCGG - Exonic
938073297 2:128319246-128319268 CTTTCCTCCCGCGCGGGCTGCGG - Intergenic
948194361 2:236084210-236084232 CCTTCCTGAAGGGCGGGGGGGGG + Intronic
1176118773 20:63444899-63444921 TCCTCCTGGAACGCGGGGTGGGG - Intronic
1181696040 22:24593172-24593194 CCTCGCTCCGGCGCGGGGTGGGG - Intronic
1184252887 22:43270961-43270983 CCTTCTTCGAGCCCTGGGTGAGG + Intronic
1185340059 22:50287167-50287189 CCCTCCACGCGGGCGGGGTGTGG + Exonic
953257658 3:41306196-41306218 CCTCCCTCCCGGGCGGGGTGGGG - Intronic
954685884 3:52369931-52369953 CCTTCATCGAGTGCTGGCTGAGG + Exonic
963763240 3:149307218-149307240 GCTTCCTAGAGCTAGGGGTGGGG + Intergenic
967848663 3:194065012-194065034 CCTGCCTCGTGCCAGGGGTGTGG + Intergenic
968221232 3:196941888-196941910 GCTTCCCCGAGGGCGGAGTGAGG + Intronic
968472571 4:788763-788785 CCTCCCTCCAGCCAGGGGTGTGG + Intronic
985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG + Intergenic
986311462 5:6553994-6554016 CCTTCCTCGTGAGCTGTGTGAGG - Intergenic
989686891 5:44099747-44099769 CCTGCCTGGAGCGCTGGTTGGGG + Intergenic
997512952 5:134465872-134465894 CCTTCCCGGAGCGGGGGGCGGGG + Intergenic
998335388 5:141366604-141366626 TCTTCCTCGAGTCCGCGGTGAGG - Exonic
999393118 5:151208674-151208696 TCTTCCTCCAGCCCAGGGTGGGG - Intronic
999919402 5:156302843-156302865 GCTTCCTGGAGCTGGGGGTGAGG + Intronic
1004134898 6:12957062-12957084 CCTTCCTAGGGGGCGGGGTGGGG + Intronic
1004900197 6:20186430-20186452 CTTTCCTGGAGCCCAGGGTGAGG + Intronic
1006647065 6:35522224-35522246 CCTGCCCCTAGCGTGGGGTGGGG - Intergenic
1007398488 6:41590409-41590431 CCTTCCTGGAGGCAGGGGTGTGG - Intronic
1009553739 6:65134594-65134616 GCCTCCTTGAGGGCGGGGTGTGG + Intronic
1017313539 6:153002530-153002552 CCTTCCTCGAGCGCCAGGCGGGG - Exonic
1018067923 6:160136603-160136625 GCTTCCTCAGGCGCGGCGTGCGG - Exonic
1019932169 7:4230802-4230824 CCTTCCTGGAACGTGGGGTGGGG + Intronic
1028417510 7:90596076-90596098 CCTTCGTCGAGGGAGGGGCGTGG + Intronic
1029270549 7:99374683-99374705 ACTTCCTCGTGGGCGGGGGGCGG - Intronic
1033653630 7:143359843-143359865 CCTTCCAGGAGTGCGGGATGTGG + Intronic
1034329126 7:150267835-150267857 CCTTCCTGGAGCAGGGGCTGAGG + Intronic
1034668930 7:152842025-152842047 CCTTCCTGGAGCAGGGGCTGAGG - Intronic
1037581368 8:20247709-20247731 CCTTCCCTGAGTGCGGGCTGAGG - Exonic
1041178348 8:55221437-55221459 CCTCCCTTGAGAGCAGGGTGTGG + Intronic
1042530123 8:69806067-69806089 CCTTCCTCTGGCGGGGGTTGGGG - Intronic
1048766251 8:137847605-137847627 GCATCCTTGAGCGCTGGGTGTGG - Intergenic
1049540605 8:143207168-143207190 CATTCCTGGAGGGCTGGGTGAGG + Intergenic
1190108264 X:47573996-47574018 CCTTACTTGAGCTGGGGGTGCGG + Exonic