ID: 1136545065

View in Genome Browser
Species Human (GRCh38)
Location 16:30949931-30949953
Sequence AAGGGTCACCCAGCTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136545065 Original CRISPR AAGGGTCACCCAGCTGAAGG TGG Intronic
900084683 1:886293-886315 AAGGCTCAGCCAGCTGAACTGGG + Intergenic
900522245 1:3111346-3111368 AAGAGTCTCCCTCCTGAAGGTGG + Intronic
901142846 1:7046387-7046409 AAGGGTCTCCCAGCTGCCGGAGG + Intronic
901427533 1:9191962-9191984 AAGGGTCACCCACTGAAAGGTGG + Intergenic
902882506 1:19381988-19382010 AAGGGCCACCCAGGGGAAGGAGG - Intronic
903115853 1:21177496-21177518 AAGGTTCATCCAGATGAAGGTGG - Intergenic
904093445 1:27960407-27960429 ACAGGTGACCCAGCTGACGGAGG - Intronic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904562129 1:31405996-31406018 AATTGTCACACAGCTGTAGGAGG + Intergenic
904617436 1:31757578-31757600 GAGGGTCACCCACCAGCAGGTGG - Intronic
906166987 1:43693889-43693911 AGTGGTCACCCAGGTGAGGGAGG + Intronic
906585803 1:46976711-46976733 GAGGGGCACCCAGCTGTATGAGG - Intergenic
907005572 1:50910255-50910277 GAGGGGCACCCGGCTGAATGAGG + Intronic
909770443 1:79414910-79414932 GAGGGGCACCCAGCTGTATGAGG - Intergenic
910283089 1:85523140-85523162 AGGGCTCACGCAGTTGAAGGAGG + Intronic
910383660 1:86658183-86658205 GAGGGGCACCCAGCTGTATGAGG - Intergenic
910717452 1:90247718-90247740 GAGGGGCACCCAGCTGCATGAGG - Intergenic
911490033 1:98553057-98553079 GAGGGGCACCCAGCTGTATGAGG - Intergenic
912618748 1:111133877-111133899 CAGGGACACTCAGCTGAAGCTGG - Intronic
912742400 1:112212383-112212405 GAGGGGCACCCAGCTGTATGAGG - Intergenic
913142396 1:115954491-115954513 AAAGGTTACTTAGCTGAAGGTGG - Intergenic
914206925 1:145539849-145539871 AGGGCTCACGCAGTTGAAGGAGG - Intergenic
914745481 1:150498241-150498263 GATGGTCACTGAGCTGAAGGAGG - Intronic
914937358 1:151993157-151993179 AAGGGTCTTCCTGCTGAGGGAGG - Intronic
915711422 1:157902574-157902596 GAGGGGCACCCAGCTGTATGAGG - Intergenic
915734630 1:158076933-158076955 TAAGGTCACCCAGCTGGCGGAGG - Intronic
916038327 1:160941280-160941302 GAGGGGCACCCAGCTGTATGAGG + Intergenic
916251925 1:162746737-162746759 GAGGGGCACCCAGCTGTATGAGG - Intronic
919332813 1:196192954-196192976 GAGGGGCACCCAGCTGTATGAGG + Intergenic
919774491 1:201185250-201185272 CAGGGTCTCCCAACTCAAGGTGG + Intergenic
920020544 1:202952566-202952588 AAGGGTGTCCCAGCTCCAGGAGG - Intronic
920085468 1:203412227-203412249 GAGGGTCACCCGGCTGTATGAGG - Intergenic
920346132 1:205306807-205306829 GAGGGTCAGCCAGATGGAGGGGG + Intronic
920781148 1:208992190-208992212 GAGGGGCACCCAGCTGTATGAGG - Intergenic
921030975 1:211334968-211334990 AAGGGCCACACAGCAGTAGGAGG - Intronic
922552279 1:226504654-226504676 GAGGGGCACCCGGCTGTAGGAGG + Intergenic
923111504 1:230894282-230894304 AGGGGTCACCCAGGCTAAGGAGG + Intergenic
924098341 1:240577988-240578010 AAAGGTCAAGAAGCTGAAGGTGG + Intronic
924207578 1:241729259-241729281 AAGGGGCTCCCAGTTGCAGGTGG + Intronic
924560769 1:245155333-245155355 AAGCGTCCCCCGGCTGCAGGGGG - Exonic
1064431137 10:15270645-15270667 AAGGGGCACCCAGCCGTATGAGG - Intronic
1066478118 10:35767842-35767864 AAGACACCCCCAGCTGAAGGAGG - Intergenic
1066655290 10:37693585-37693607 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1067046519 10:42988377-42988399 CAGGGTCACCCAGATGCTGGGGG + Intergenic
1068641534 10:59413693-59413715 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1069355851 10:67584440-67584462 GAGGGTCACCCAGCTGTATGAGG + Intronic
1069769606 10:70888785-70888807 CAGGGCCACCCAGCTGTAAGCGG - Intergenic
1070388407 10:75947581-75947603 CAAGGTCACCCAGCTAAAAGGGG - Intronic
1071875664 10:89840247-89840269 AACAGTCACCAAGCTGTAGGTGG - Intergenic
1072769862 10:98128659-98128681 AAGGGTCACACTGCTGAAAAAGG + Intergenic
1074851507 10:117443003-117443025 AAGGGCCCCCCAGCTGCTGGAGG + Intergenic
1077201296 11:1309011-1309033 AATGGTCCCCCAGGTGGAGGCGG - Intronic
1079136285 11:17777490-17777512 AAGGGTCTCCGGGCTGAGGGAGG - Intronic
1080365994 11:31574552-31574574 GAGGGGCACCCAGCTGTATGAGG - Intronic
1081587362 11:44396594-44396616 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1082136852 11:48558978-48559000 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1083359455 11:62096002-62096024 AATGGTTACCCAGCTCAAGGCGG + Intergenic
1083359995 11:62100016-62100038 AATGGTTACCCAGCTCAAGGCGG - Intergenic
1083397749 11:62402882-62402904 AAGGGTCTCACAGTTGAATGGGG - Intergenic
1083682333 11:64357369-64357391 GGGGATCCCCCAGCTGAAGGAGG + Exonic
1083936760 11:65873384-65873406 AAGGACCACCCGGCTGAAGACGG - Intronic
1084242126 11:67828953-67828975 CATGGTCACCCAGCTGAGGAAGG + Intergenic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1085457124 11:76671321-76671343 AAGGGTCCCGCAGATGATGGAGG - Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1087718911 11:101639626-101639648 GAGGGGCACCCAGCTGTATGAGG - Intronic
1089731745 11:120523645-120523667 CAGGGTCACACAGCTGAACCTGG + Intronic
1091804711 12:3347639-3347661 CAGGGTCACACTGCTGTAGGTGG - Intergenic
1092064160 12:5575883-5575905 CAACGTCAGCCAGCTGAAGGAGG - Exonic
1094005217 12:25741890-25741912 AAAAGTCACCCAGCTAATGGTGG - Intergenic
1095140613 12:38657639-38657661 GAGGGGCACCCAGCTGTATGAGG - Intronic
1095672470 12:44876648-44876670 AAAGACCACCCAGCTGCAGGAGG + Exonic
1095913877 12:47457172-47457194 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1097917419 12:65035827-65035849 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1098638444 12:72812941-72812963 TAGGGGCACCCAGCTGTATGAGG + Intergenic
1100378438 12:94039403-94039425 AAGGCCCACCCATCTGATGGAGG + Intergenic
1100670086 12:96802371-96802393 AAGGCCCACCCAGCTAAGGGAGG + Intronic
1101002578 12:100371506-100371528 AAGGATCATCCAGCTGCAGCTGG - Intronic
1101256643 12:102984371-102984393 AAGTGTCAGCCAGGTGAAGATGG + Intergenic
1101909906 12:108853593-108853615 AAGGGACACCCACCAGGAGGTGG + Intronic
1104353295 12:128063582-128063604 AAGGTTCACCCAGTTGCAAGTGG - Intergenic
1105583731 13:21724656-21724678 AGATGTCACTCAGCTGAAGGTGG + Intergenic
1105821765 13:24086739-24086761 AAGGGCCAGCCAGCAGAAGCGGG + Intronic
1105837819 13:24225841-24225863 ATGGCTCGCCCAGCTGCAGGTGG - Intronic
1106753207 13:32796071-32796093 GAGGGACACGCAGCTGAAGGAGG - Intergenic
1108264968 13:48697278-48697300 GAGGGTCACCCAGCTGTATGAGG - Intronic
1108308510 13:49163012-49163034 GAGGGGCACCCAGCTGTATGAGG + Intronic
1108761745 13:53575533-53575555 AAAGTTCACCCAGCTGAGAGTGG + Intergenic
1108988827 13:56629432-56629454 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1109222557 13:59655208-59655230 AAGGCTAACCGAGCTGAAAGGGG - Intergenic
1111044726 13:82799551-82799573 AAGGGTGAGGCAGCTGAAAGTGG + Intergenic
1111375082 13:87368106-87368128 TAGGGGCACCCAGCTGTATGAGG + Intergenic
1113034773 13:106037092-106037114 AAGGGCCACCCAGCTGCTGGTGG + Intergenic
1114411918 14:22508994-22509016 AAGGGTCACACAGCCAAAGACGG + Intergenic
1114430667 14:22657674-22657696 CCTGGTCACCCAGCTGGAGGGGG - Intergenic
1114599555 14:23943198-23943220 GAGGGGCACCCACCTGTAGGAGG - Intergenic
1114796489 14:25720934-25720956 CAGGGGCACCCAGCTGTATGAGG + Intergenic
1115184056 14:30664587-30664609 AAGTTTCTCCAAGCTGAAGGAGG + Intronic
1115362359 14:32517963-32517985 GAGGGGCACCCAGCTGTATGAGG - Intronic
1117287999 14:54306136-54306158 CAAGGTCACCTAGCTGAAAGTGG - Intergenic
1117685130 14:58245044-58245066 ATGGCCCACCCAGCCGAAGGCGG - Intronic
1117856717 14:60042122-60042144 GAGGGGCACCCAGCTGTATGAGG + Intronic
1118305834 14:64654580-64654602 AACGGAAACCCAGCTGAAGTAGG + Intergenic
1118974288 14:70663954-70663976 GAAGGTCACCCAGCTGGAAGGGG - Intronic
1119653680 14:76401315-76401337 CAGTGTCACCCAGCTGATGGTGG + Intronic
1119779238 14:77267079-77267101 CAAGGTCACCCAGCTGATGAAGG - Intronic
1121469240 14:94139041-94139063 AAGTGTCACCCTGCTGCAGTAGG - Intergenic
1121702848 14:95969003-95969025 AAGGAGGACCAAGCTGAAGGAGG - Intergenic
1122047639 14:99035089-99035111 AAAGGTCCCCCAGGTGAAGTGGG - Intergenic
1122347454 14:101069389-101069411 CAAGGTCACCCAGCTGGAGGTGG + Intergenic
1123949455 15:25256342-25256364 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1124590488 15:31049260-31049282 ACGGACCTCCCAGCTGAAGGAGG + Intronic
1128136363 15:65266530-65266552 AAGGGACACCCTGCTGATGTGGG - Intronic
1128875237 15:71196136-71196158 AAGAGCAAGCCAGCTGAAGGTGG + Intronic
1130713663 15:86310557-86310579 AAGGGTCAGCCTGGTGCAGGGGG + Intronic
1131093997 15:89644853-89644875 CAGGGTCACACAGCTGGAAGAGG + Intronic
1131477824 15:92755375-92755397 GAGGGGCACCCAGCTGTATGAGG - Intronic
1133035924 16:3034246-3034268 CAGGGTCACACAGCTGGACGAGG + Intronic
1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG + Intronic
1133130932 16:3675786-3675808 AAGGGCCACGCAGAGGAAGGAGG + Intronic
1133330933 16:4973444-4973466 CAGTGTCACCCAGCTGATGAAGG - Intronic
1133353638 16:5119888-5119910 CACGGTCACCCAGCTGAGGAAGG + Intergenic
1133635666 16:7662696-7662718 AAAAGTCACCCAGCTGCAGGTGG + Intronic
1133932968 16:10247322-10247344 AAGGGGCAGCCACTTGAAGGAGG + Intergenic
1134814687 16:17196131-17196153 TAGGGTCTCCCAGCAGATGGTGG + Intronic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136414610 16:30095841-30095863 GAGGGTCCCCCACCTGGAGGAGG + Exonic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1136632940 16:31499687-31499709 AAGGTTCTCCCAGCTAATGGTGG - Intronic
1137023326 16:35451568-35451590 CAGGTGCCCCCAGCTGAAGGTGG + Intergenic
1137335655 16:47546488-47546510 GAGGGGCACCCAGCTGTATGAGG + Intronic
1137471135 16:48759453-48759475 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1137680937 16:50344031-50344053 GAGGGGCACCCAGCTGTATGAGG - Intronic
1138007261 16:53349762-53349784 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1138304090 16:55958249-55958271 AAGGGACACACAGCTGAAAAAGG - Intergenic
1138713154 16:58992628-58992650 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1140054089 16:71510555-71510577 GAGGGGCACCCAGCTGTATGAGG + Intronic
1140142031 16:72267231-72267253 AAGGATCCCTCAGGTGAAGGAGG - Intergenic
1143568450 17:7739559-7739581 GAGGGCCAACCAGCTGCAGGGGG - Intronic
1145101627 17:20081917-20081939 AACGGCCAGCCAGCTGCAGGTGG - Intronic
1146178961 17:30685157-30685179 CAGGGTGACCCTTCTGAAGGGGG + Intergenic
1146600883 17:34215123-34215145 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1146688437 17:34856967-34856989 AGGGCTCACCCAGGAGAAGGTGG + Intergenic
1146951866 17:36912557-36912579 AAAGGCCACACAGATGAAGGAGG - Intergenic
1147902436 17:43797865-43797887 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1149443922 17:56699118-56699140 AAGGGTAAAACAGATGAAGGTGG - Intergenic
1150161947 17:62905977-62905999 AACAGCCACCCAGATGAAGGAGG - Intergenic
1153860788 18:9203240-9203262 AAGGTTCACTCAACTGAAAGAGG - Intronic
1154193765 18:12251580-12251602 CAAGGTCACCCAGCTAGAGGAGG + Intergenic
1154401514 18:14042960-14042982 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1156443788 18:37219214-37219236 AAGGGGCACCCAGCTGTATGAGG + Intronic
1159058227 18:63488140-63488162 AAGCCTCAGCCAGATGAAGGAGG - Intronic
1161103606 19:2433038-2433060 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103640 19:2433143-2433165 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103675 19:2433248-2433270 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103710 19:2433353-2433375 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103743 19:2433458-2433480 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103778 19:2433563-2433585 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103813 19:2433668-2433690 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103848 19:2433773-2433795 CGGGGTGACCCAGCTGATGGGGG - Intronic
1162979652 19:14230397-14230419 CAGGGTGACCCTTCTGAAGGGGG - Intergenic
1163007606 19:14406383-14406405 GAGGCTCATCCAGCAGAAGGCGG - Exonic
1163325948 19:16603355-16603377 AAGTGCCAGCCAGCTGGAGGTGG + Intronic
1163417399 19:17194967-17194989 AAGGGTCACCCAGGAGCAAGGGG + Exonic
1164111188 19:22160899-22160921 GAGGGCCACCCAGCTGTATGAGG + Intergenic
1164394869 19:27853436-27853458 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1164688598 19:30190038-30190060 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1165957995 19:39514105-39514127 AAGGGTTAGCCAGGTAAAGGAGG - Intergenic
1165973109 19:39649929-39649951 AAGGGGCACCCACCTGTATGAGG - Intergenic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
1167624422 19:50578141-50578163 AAGGCTCAGCCAGGTGAAAGAGG - Intergenic
925720797 2:6824805-6824827 AAGGGTCTACCATCAGAAGGAGG + Intergenic
926814032 2:16782622-16782644 AAGGGACAGCCACCTGAAGCTGG - Intergenic
926941697 2:18144538-18144560 GAGGGGCACCCAGCTGTATGAGG + Intronic
930146743 2:48015056-48015078 CAGGGTCTCCCAGATGAAGAGGG + Intergenic
931123695 2:59249908-59249930 AAGTGACACCCAGCTCAAGATGG - Intergenic
931558536 2:63531454-63531476 GAGGGGCACCCAGCTGTATGAGG - Intronic
932019138 2:68064510-68064532 GAGGGGCACCCAGCTGTATGAGG - Intronic
932415797 2:71573274-71573296 AAGGGGCACCCAGCAGACAGAGG + Intronic
932662615 2:73669875-73669897 GAGGGGCACCCAGCTGTATGAGG + Intergenic
936515190 2:113176884-113176906 ACCGGTCACCCAGGTGAGGGCGG - Intronic
936823593 2:116553536-116553558 GAGGGGCACCCAGCTGTATGAGG - Intergenic
937061035 2:118980685-118980707 CACGGACACCCAGCTGATGGTGG + Intronic
937445523 2:121954860-121954882 GAGGCTCACCCACATGAAGGAGG + Intergenic
937983645 2:127628935-127628957 CAGGGTCACACAGCTCAAGGGGG + Intronic
939055614 2:137360968-137360990 GAGGGGCACCCAGCTGTATGAGG - Intronic
940644382 2:156375634-156375656 GAGGGGCACCCAGCTGTATGAGG + Intergenic
941100242 2:161286920-161286942 GAGGGGCACCCAGCTGTATGAGG - Intergenic
941360962 2:164550954-164550976 AACTGTCACTGAGCTGAAGGTGG - Intronic
941896151 2:170630662-170630684 GAGGGGCACCCAGCTGTATGAGG - Intronic
942854722 2:180531969-180531991 GAGGGGCACCCAGCTGTATGGGG + Intergenic
945674754 2:212842692-212842714 AAGGGTCACCCAGCTGGTTGTGG - Intergenic
946031906 2:216712075-216712097 CAAGGTCACTCAGCTGAGGGAGG - Intergenic
946687941 2:222290753-222290775 AAGCGTCACCCTGCTGGAGGGGG + Intronic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
947838541 2:233192091-233192113 GAGGGTCCCCAAGCTGCAGGAGG + Intronic
948213705 2:236213713-236213735 AAGGGTGAGCCAGCAGAATGGGG + Intronic
948242500 2:236449308-236449330 AAGGATCACTCTGCTGTAGGAGG + Intronic
949077562 2:242070733-242070755 AAAGGACACCCAGCTGCAGGTGG - Intergenic
1169659016 20:7957908-7957930 GAGGGTCACCCAGCTGTATGAGG + Intergenic
1169759308 20:9074140-9074162 CAGGGTCACACAGCTAAAAGAGG - Intronic
1170422265 20:16204725-16204747 AGAAGTCACCCAGCTTAAGGTGG + Intergenic
1170656300 20:18290065-18290087 AAGTGGCACCCACCTGAAGCTGG - Exonic
1172899517 20:38324201-38324223 CTGGGTCACCCAGCTGGAGAGGG - Intronic
1173232046 20:41205914-41205936 GAGGGGCACCCAGCTGTATGAGG - Intronic
1175467929 20:59205177-59205199 AAAGGTGACCCAGCAGCAGGTGG + Intronic
1175767112 20:61599305-61599327 CAGAGTCCCCCAGCAGAAGGAGG - Intronic
1179402084 21:41093796-41093818 CAGTGTCACCCTGCTGATGGTGG + Intergenic
1181802939 22:25359015-25359037 CAGGGTCACACAGCAGGAGGTGG - Intronic
1183078895 22:35443809-35443831 AAGGGGCACCATCCTGAAGGAGG - Intergenic
1183961555 22:41414391-41414413 TAAGGTCACCCAGAGGAAGGTGG - Intergenic
1185269793 22:49924065-49924087 AATGGTCACCGAGCTGGAGGTGG + Intronic
949456570 3:4245622-4245644 GAGGGTCACCCACCTGTATGAGG + Intronic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
949781135 3:7689970-7689992 AAGTGTCACCAAGCTACAGGTGG + Intronic
949931598 3:9082874-9082896 AAGAATCACCCCTCTGAAGGTGG + Intronic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
950449273 3:13056427-13056449 AAGGGTCTGACATCTGAAGGAGG - Intronic
950792576 3:15485271-15485293 GAGGGGCACCCAGCTGTATGAGG + Intronic
951155681 3:19350495-19350517 GAGGGGCACCCAGCTGCATGAGG - Intronic
951617851 3:24567908-24567930 AAAGTTCTCCAAGCTGAAGGAGG + Intergenic
952889943 3:38032977-38032999 GAGGGTAACTCACCTGAAGGAGG + Intergenic
953337345 3:42104463-42104485 GAGGGGCACCCAGCTGTATGAGG - Intronic
954627891 3:52032698-52032720 CACGGTCACACAGCTGTAGGTGG + Intergenic
955409847 3:58648474-58648496 CAGGGTCACACAGCTGTAAGTGG - Intronic
956217300 3:66861691-66861713 CAGGGCCACCTAGCTGGAGGTGG + Intergenic
956770589 3:72522725-72522747 AAGGGTTTCCAAGCTGGAGGAGG - Intergenic
958897956 3:99850985-99851007 AAGGGTCACCACCCTGAAAGAGG - Exonic
959736526 3:109665471-109665493 GAGGGGCACCCAGCTGTATGAGG - Intergenic
961396038 3:126591380-126591402 GAGGGCCACCCAGCTGTATGAGG + Intronic
961552902 3:127679292-127679314 ATGGGTTACCCAGGTAAAGGAGG + Intronic
962267738 3:133955545-133955567 AAGGGGCACCCAGCTGGAAAAGG + Intronic
965393106 3:168129020-168129042 GAGGGGCACCCAGCTGTATGAGG - Intergenic
966249460 3:177846811-177846833 AAGGGTCAGCCAGATCAAGTAGG + Intergenic
968939773 4:3631682-3631704 AGGGGTCACCCCACTGAATGGGG + Intergenic
970983040 4:22123765-22123787 GAGGGGCACCCAGCTGTATGAGG - Intergenic
971621263 4:28856885-28856907 GAGGGGCACCCAGCTGTATGAGG + Intergenic
972685671 4:41350198-41350220 GAGGGGCACCCAGCTGTATGAGG - Intergenic
973626006 4:52773536-52773558 GAGGGGCACCCAGCTGTATGAGG + Intergenic
974127582 4:57714855-57714877 GAGGGGCACCCAGCTGTATGAGG - Intergenic
974176732 4:58334085-58334107 AAGGGGCACCCAGCTGTATGAGG - Intergenic
975753532 4:77549721-77549743 GAGGGGCACCCAGCTGTATGAGG + Intronic
977219736 4:94325162-94325184 GAGGGACACCCAGCTGTATGAGG + Intronic
978188053 4:105880915-105880937 GAGGGGCACCCAGCTGTATGAGG - Intronic
979934124 4:126670476-126670498 GAGGGGCACCCAGCTGTATGAGG - Intergenic
981208016 4:142067091-142067113 GAGGGGCACCCAGCTGTATGAGG - Intronic
981271961 4:142856082-142856104 AAGGGTAACTCAGATGGAGGGGG - Intergenic
982702978 4:158676435-158676457 AAGAGTCATGCAGCTGGAGGTGG - Intronic
983334465 4:166374654-166374676 GAGGGGCACCCAGCTGTATGAGG + Intergenic
983987195 4:174073698-174073720 CAGGCTCAGCCAGCAGAAGGAGG - Intergenic
986752459 5:10801044-10801066 ATGGGTGACCCAGCAGAAGTAGG + Intergenic
987611593 5:20211510-20211532 GAGGGGCACCCGGCTGAATGAGG - Intronic
988187780 5:27889273-27889295 GAGGGGCACCCAGCTGTATGAGG + Intergenic
988309675 5:29541557-29541579 GAGGGTCACCCACCTGTATGAGG + Intergenic
988540197 5:32101475-32101497 TAGGGTCACACAGCTGTAAGTGG + Intronic
989096918 5:37790370-37790392 TGGGGTCACCCAGCTGTAAGTGG - Intergenic
989418305 5:41205986-41206008 GAGGGGCACCCAGCTGTATGAGG - Intronic
989562075 5:42863573-42863595 GAGGGGCACCCAGCTGTATGAGG - Intronic
989608154 5:43265997-43266019 GAGGGTCACCCAGCTGTGTGAGG + Intronic
989623053 5:43403279-43403301 GAGGGTCACCCGGCTGTATGAGG - Intronic
990164062 5:52975986-52976008 GAGGGGCACCCAGCTGTATGAGG + Intergenic
990244818 5:53854077-53854099 GAGGGGCACCCAGCTGTATGAGG + Intergenic
990757139 5:59086129-59086151 AAGGGTCACATAGCTAAAAGTGG + Intronic
993619154 5:90147515-90147537 GAGGGTTACCCAGCTGTGGGAGG - Intergenic
994117165 5:96073769-96073791 CAGGGTCGCACAGCAGAAGGTGG - Intergenic
994172078 5:96668917-96668939 AAGGGTCACCTTGCAGAAGCTGG + Intronic
994284865 5:97952632-97952654 AAAGGTCCCCCACCTAAAGGTGG + Intergenic
995402816 5:111760654-111760676 AAGAGTCAGCAAGTTGAAGGAGG + Intronic
995459818 5:112390810-112390832 GAGGGGCACCCAGCTGTATGAGG - Intronic
995529001 5:113074148-113074170 AAGGGGCACCCAGCTGTATGAGG - Intronic
995749905 5:115442646-115442668 GAGGGTCACCCAGCAGTATGAGG - Intergenic
995750062 5:115444244-115444266 GAGGGGCACCCAGCTGTATGAGG + Intergenic
997432733 5:133851972-133851994 GAGGGGCACCCAGCTGTATGAGG - Intergenic
999055460 5:148570652-148570674 AAGGGTCACACATCAGGAGGGGG + Intronic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1000595749 5:163212721-163212743 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1001076445 5:168631454-168631476 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1001253743 5:170168039-170168061 CAAGGTCACACCGCTGAAGGTGG + Intergenic
1001957593 5:175858738-175858760 GAGTGTCTCTCAGCTGAAGGTGG - Intronic
1002168184 5:177360947-177360969 AAGGGTCTGCAAGCTGGAGGAGG + Intronic
1004342065 6:14816679-14816701 CAAGGTCACCCAGCAGATGGAGG + Intergenic
1006113794 6:31764456-31764478 AGGAGTCACCCAGCCAAAGGAGG + Exonic
1007794393 6:44335885-44335907 AGGGGTCACCTAGCTCATGGTGG - Intronic
1008474545 6:51922329-51922351 GAGGGGCACCCAGCTGTATGAGG + Intronic
1009361320 6:62818162-62818184 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1013258305 6:108411524-108411546 GAGGGGCACCCAGCTGTATGAGG - Intronic
1013413690 6:109905525-109905547 CAGGCTCTACCAGCTGAAGGTGG + Intergenic
1013517883 6:110905050-110905072 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1014272115 6:119348016-119348038 AAGGGCCACACAGCTGAACCCGG + Intronic
1015893178 6:137989529-137989551 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1017293803 6:152771415-152771437 AAGGGCCCTCCAGCTGAGGGAGG - Intergenic
1018114032 6:160565291-160565313 GAGGGGCACCCAGCTGTATGAGG - Intronic
1019382628 7:732374-732396 ATGAGTCACCCACCTGAGGGCGG - Intronic
1019942760 7:4304188-4304210 AGTGGTCACCCAGCAGAGGGTGG - Intergenic
1020235001 7:6348560-6348582 ACGGCTCACCCACCTGCAGGCGG + Exonic
1020349350 7:7201376-7201398 GAGGGGCACCCAGCTGTATGAGG + Intronic
1020640489 7:10747822-10747844 GAGGGGCACCCGGCTGAATGAGG - Intergenic
1021459295 7:20867486-20867508 AAGGGTCTCCCATCTGAAAATGG - Intergenic
1022646093 7:32229729-32229751 CAAGGTCACACAGCTGGAGGTGG + Intronic
1022823742 7:33987571-33987593 AAGGTGCACCCAGATCAAGGAGG - Intronic
1023065995 7:36378479-36378501 GAGGGGCACCCAGCTGTATGAGG + Intronic
1024224712 7:47317244-47317266 AAGGGTCACCCGGCTTTTGGTGG - Intronic
1026104751 7:67411920-67411942 AGGGGTCACACAGCAGCAGGGGG - Intergenic
1027252796 7:76409694-76409716 AAAGGGCACCCAGGTGGAGGCGG + Exonic
1028022267 7:85791650-85791672 GAGGGACACCCAGCTGTATGAGG - Intergenic
1028578596 7:92380949-92380971 AAACTTCTCCCAGCTGAAGGAGG + Intronic
1028999600 7:97139280-97139302 AGTGGTCCCCCACCTGAAGGTGG + Intronic
1029062335 7:97811076-97811098 GAGGGTCACCCAGCTGTATGAGG - Intergenic
1029157164 7:98525545-98525567 AAGGGGCATCCAGCTGTATGGGG + Intergenic
1030181131 7:106710144-106710166 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1030220965 7:107098889-107098911 TAGGGGCACCCAGCTGTATGAGG + Intronic
1030289535 7:107858548-107858570 AAGAGGCACGCAGCAGAAGGAGG - Intergenic
1030536324 7:110771490-110771512 CAAGGTCACACAGCTGAAAGTGG - Intronic
1032269295 7:130388949-130388971 CAGGATCACCAAGCTGAAGAAGG - Intergenic
1033293396 7:140108643-140108665 GAGGGGCACCCAGCTGTATGAGG + Intronic
1034938823 7:155217004-155217026 ATGGGTCAGCCAGCTCTAGGGGG - Intergenic
1035536117 8:392618-392640 AAAGGACACCCAGCTGCAGGTGG - Intergenic
1037905076 8:22711478-22711500 AAGGGAAACCAAACTGAAGGGGG + Intergenic
1038071230 8:24015954-24015976 AAAGCTCAACGAGCTGAAGGAGG + Intergenic
1038223199 8:25630346-25630368 CAGGGTCACACAGCTGATGGGGG - Intergenic
1038260284 8:25986958-25986980 AAGTGTCACAGAGCTGATGGGGG - Intronic
1038517944 8:28202992-28203014 ATGGGTCCCCCAGCAGCAGGTGG - Intergenic
1038945572 8:32355882-32355904 AATGGTCTTCCAGATGAAGGAGG + Intronic
1040016294 8:42702949-42702971 CAGGGCCATCCAGCTGATGGTGG - Intronic
1040071036 8:43189006-43189028 GAGGGGCACCCAGCTGTATGGGG + Intronic
1040383419 8:46894701-46894723 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1041665857 8:60444359-60444381 AAGGGGCATCCAGCTGTATGAGG + Intergenic
1042638537 8:70906001-70906023 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1042887629 8:73569577-73569599 GAGGGGCACCCAGCTGTATGAGG - Intronic
1043497986 8:80823689-80823711 GAGGGGCACCCAGCTGTATGAGG - Intronic
1044960710 8:97528412-97528434 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1045086088 8:98687467-98687489 CCGGGTCACACAGCTGGAGGTGG - Intronic
1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG + Intronic
1045886891 8:107108703-107108725 CAGGGAGACCCAGCGGAAGGTGG - Intergenic
1048302814 8:133264159-133264181 AAGGGTCAGTCATCTGAGGGTGG + Intronic
1049337512 8:142094290-142094312 CAAGGTCACACAGCTGCAGGTGG - Intergenic
1049484899 8:142850690-142850712 GAGGGCCACCCAGCTGTATGAGG - Intronic
1049532508 8:143161427-143161449 ACAGGTGACCCAGCTGAAGTGGG + Intergenic
1049993074 9:1008240-1008262 AAGGGGCATCCAGCTGTCGGTGG - Intergenic
1051086996 9:13361465-13361487 AAGGGCCAACCAGCTGAGGATGG - Intergenic
1051213915 9:14776040-14776062 CAGGGTCGGTCAGCTGAAGGAGG + Exonic
1051295481 9:15590621-15590643 AAGGGTCACAAAGCTGAGGCTGG - Intronic
1052359741 9:27541117-27541139 AAAGTTCACCCAGGTGAAGTGGG + Intergenic
1052887796 9:33666764-33666786 GAGGGGCACCCAGCTGAATGAGG - Intergenic
1053287355 9:36858687-36858709 GAGGGTCTCCAAGCTGGAGGGGG - Intronic
1054450987 9:65403628-65403650 AGGGGTCACCCCACTGAATGGGG - Intergenic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1055053152 9:71999877-71999899 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1057779690 9:98039549-98039571 AAGAGTCACACAGCTGGAGGGGG + Intergenic
1057955496 9:99403902-99403924 AGGGGTCACCCAGCTCTAGGAGG + Intergenic
1058012060 9:99989296-99989318 GAGGGGCACCCAGCTGTATGAGG - Intronic
1058440060 9:104998410-104998432 AATTGTCACCAAGCTCAAGGAGG - Intergenic
1058481821 9:105403684-105403706 CAGGGAGACCCACCTGAAGGTGG + Intronic
1059639230 9:116200288-116200310 CAATGACACCCAGCTGAAGGAGG - Intronic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060549995 9:124480545-124480567 AAAGGTCACACAGCTAAAAGCGG - Intergenic
1060745255 9:126126962-126126984 AAGGACCCCCCAGCTGAAGCTGG - Intergenic
1061130814 9:128706748-128706770 GCGGGACAGCCAGCTGAAGGTGG + Exonic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1061325452 9:129861240-129861262 CAGGGTCACCCAGCTGGGAGAGG - Intronic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1061873497 9:133532828-133532850 GAGGGTCACACACCTGCAGGAGG + Intronic
1061935610 9:133855996-133856018 AAGGTTCACCCAGCCGTAGCCGG - Intronic
1186563624 X:10638774-10638796 GAGGGGCACCCAGCTGTATGAGG - Intronic
1188401789 X:29754644-29754666 AAAGGTGACCAAGCTAAAGGAGG - Intronic
1189729367 X:44002762-44002784 AAAGAACACACAGCTGAAGGAGG + Intergenic
1190209626 X:48434202-48434224 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1190979572 X:55443963-55443985 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1191864200 X:65690740-65690762 AAAGGCCATCCAGCTGAAGCAGG - Intronic
1191882364 X:65856046-65856068 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1192066314 X:67889332-67889354 AAGGGGCACACAGCTGTACGAGG + Intergenic
1193035935 X:76951132-76951154 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1193315997 X:80065945-80065967 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1193733787 X:85133038-85133060 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1194752698 X:97702479-97702501 AAGGGTCCCCTAGTTGAGGGTGG - Intergenic
1196799671 X:119531320-119531342 AAGGACCACCCAGCAGAAGCAGG - Intergenic
1196853628 X:119962222-119962244 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1197478057 X:126947522-126947544 GAGGGTCACCCAGCTTTATGAGG - Intergenic
1198168434 X:134080216-134080238 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1198376932 X:136049758-136049780 AAGGGTCAGCCATGTGAAGCAGG + Intergenic
1200061339 X:153485114-153485136 CGGGGGCTCCCAGCTGAAGGTGG + Intronic
1200805462 Y:7428734-7428756 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1201178741 Y:11326079-11326101 AAGGATCACCCAGGTGATGCAGG - Intergenic
1201393053 Y:13519678-13519700 AAGGGGCACCCAGCTGTATGAGG + Intergenic
1201776109 Y:17667963-17667985 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1201825447 Y:18238029-18238051 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1201992387 Y:20042231-20042253 GAGGGGCACCCAGCTGTATGAGG + Intergenic