ID: 1136545741

View in Genome Browser
Species Human (GRCh38)
Location 16:30953696-30953718
Sequence GGGTACCATGATGGCTGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136545741_1136545747 -4 Left 1136545741 16:30953696-30953718 CCTCCACAGCCATCATGGTACCC 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1136545747 16:30953715-30953737 ACCCGTGGGGCTCGTGTTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 60
1136545741_1136545754 29 Left 1136545741 16:30953696-30953718 CCTCCACAGCCATCATGGTACCC 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1136545754 16:30953748-30953770 GCATTTCTACCGCTCCTTGGTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1136545741_1136545753 26 Left 1136545741 16:30953696-30953718 CCTCCACAGCCATCATGGTACCC 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1136545753 16:30953745-30953767 CCTGCATTTCTACCGCTCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136545741 Original CRISPR GGGTACCATGATGGCTGTGG AGG (reversed) Exonic
900132530 1:1093452-1093474 GGGCACCGTCCTGGCTGTGGTGG - Intronic
900145282 1:1156514-1156536 GGGGACGAGGGTGGCTGTGGAGG + Intergenic
900426506 1:2582536-2582558 GGGTAACATGATTGTTGCGGGGG + Intergenic
901123533 1:6913431-6913453 CGTTACCATGATGGCTCTGCTGG - Intronic
901638528 1:10681481-10681503 GGGACCCATGAAGGCTGTGTAGG - Intronic
902275397 1:15336037-15336059 GGATACCAAGATGGCGGAGGAGG - Intronic
903331329 1:22598488-22598510 GGGGGGCATGCTGGCTGTGGTGG + Intronic
904463766 1:30695827-30695849 GGGTACCATGCAGGCTGGGCGGG + Intergenic
906145534 1:43558120-43558142 GGGTACGAGGAGGGCTGGGGAGG + Intronic
906477820 1:46181645-46181667 GGATACCATGATGGGTGCTGGGG + Intronic
913676138 1:121142430-121142452 GGGCGCCATGGTGGCAGTGGAGG + Intergenic
915529247 1:156493948-156493970 GGGGCCCATGATGGCTGGGTGGG - Intronic
915891278 1:159776217-159776239 GAGAACCATGCTGTCTGTGGGGG - Intergenic
920088179 1:203433109-203433131 GGGAACCAGGATGGTTGTGCTGG + Intergenic
920463506 1:206161268-206161290 GGGCGCCATGGTGGCAGTGGAGG + Intergenic
921120802 1:212135191-212135213 CTGTACCTTGATGGCGGTGGTGG + Intergenic
922045903 1:221946077-221946099 AGGTACCATGATGGCAATGGGGG - Intergenic
922236184 1:223724285-223724307 GGGTTCCATGAGGTCTGTTGGGG + Intronic
922833399 1:228614367-228614389 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922834516 1:228618849-228618871 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922835627 1:228623284-228623306 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922836743 1:228627765-228627787 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922837863 1:228632248-228632270 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922838421 1:228634488-228634510 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922838979 1:228636713-228636735 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922839539 1:228638954-228638976 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922840100 1:228641185-228641207 GGGTAGCATGGCGACTGTGGGGG + Intergenic
922840660 1:228643426-228643448 GGGTAGCATGGCGACTGTGGGGG + Intergenic
923685920 1:236153925-236153947 CGATGCCAGGATGGCTGTGGAGG + Intronic
1066000888 10:31103256-31103278 GGGAACGAGGCTGGCTGTGGAGG + Intergenic
1066659842 10:37728457-37728479 GGGGACCATGGTGGGTATGGGGG - Intergenic
1066758781 10:38736303-38736325 AGGAACCATGGTGGGTGTGGGGG - Intergenic
1067048924 10:43000999-43001021 CAGTTCCATGATGGCAGTGGGGG + Intergenic
1067739847 10:48887183-48887205 AGGCACCATGGAGGCTGTGGTGG + Intronic
1067794113 10:49308294-49308316 GGGTGCCATGATGGCAGTGTTGG - Intronic
1067823893 10:49555399-49555421 AGGTACTCTGATGGTTGTGGGGG + Intergenic
1070911852 10:80125927-80125949 GGGAGCCATGGTGGCAGTGGAGG - Intergenic
1070934329 10:80281636-80281658 GGGAAGGAAGATGGCTGTGGGGG - Intronic
1071837711 10:89435901-89435923 TGGGACCATGATGGTTTTGGGGG + Intronic
1073042026 10:100614394-100614416 AGGTACCAGGCTGGCTGTGAGGG + Intergenic
1078511284 11:11986098-11986120 GGGTACCCGGGTGGCTGGGGTGG - Intronic
1080600314 11:33816240-33816262 GGGTACCATGAGCACTGTGCAGG - Intergenic
1080723594 11:34872857-34872879 GGTTACCAAGATGGATGTCGGGG - Intronic
1081008396 11:37776415-37776437 GGATACCAATATGGCTGAGGTGG - Intergenic
1082782737 11:57300144-57300166 GGGCACCAAGATGGGTGTAGGGG - Intronic
1083170743 11:60922732-60922754 GGGTCCCCTGAGGCCTGTGGGGG + Exonic
1083267483 11:61553492-61553514 GGCTCCCAGGATGTCTGTGGGGG - Intronic
1088474324 11:110219537-110219559 TGGAACACTGATGGCTGTGGAGG + Intronic
1088598606 11:111457205-111457227 GGGCACCTTGATGCCTGTGACGG - Intronic
1089072001 11:115707786-115707808 CAGTCACATGATGGCTGTGGAGG - Intergenic
1092397320 12:8139065-8139087 GGGTAAAATGATGGTTGTGAGGG - Intronic
1095633862 12:44408446-44408468 GAGAACCATGGTGGTTGTGGTGG + Intergenic
1096106891 12:49001286-49001308 GTGTTGCATCATGGCTGTGGAGG - Intergenic
1099077015 12:78122324-78122346 AGGAGCCATGATGGCTGAGGGGG - Exonic
1100976562 12:100128704-100128726 GCGTTCCCTGCTGGCTGTGGTGG - Intronic
1101755577 12:107618396-107618418 GGGCACCATGGTGCCCGTGGTGG - Intronic
1101968127 12:109294605-109294627 GGGTACCAGGAGCACTGTGGTGG + Intronic
1102636632 12:114330312-114330334 GGGTACCATGTTTGCTGTCTGGG - Intergenic
1102904369 12:116662782-116662804 GGGGGCCAAGAGGGCTGTGGAGG + Intergenic
1103028032 12:117589906-117589928 GGGGCCCTTGATGGCTATGGAGG + Intronic
1103138442 12:118527799-118527821 GAGTTCCATGAGGGCTGTGTTGG - Intergenic
1103537241 12:121641450-121641472 GGGCACCATGATGGTGGTCGAGG - Exonic
1105274373 13:18906117-18906139 GGGAACCATGGCGGGTGTGGGGG - Intergenic
1105806277 13:23953337-23953359 GGGAACCATGGCGGGTGTGGGGG + Intergenic
1105905094 13:24801508-24801530 GTGCACCATGAAGGCTGAGGTGG + Intronic
1108118632 13:47159886-47159908 TGTTACAATGATGGCAGTGGCGG + Intergenic
1108352745 13:49602012-49602034 GGGGACAATGATGGCAGAGGTGG - Intergenic
1109909762 13:68893666-68893688 GGGGACCATCATGATTGTGGAGG + Intergenic
1111856693 13:93646790-93646812 CTGTATCATGATGTCTGTGGTGG + Intronic
1112301517 13:98235144-98235166 GGCTTCTTTGATGGCTGTGGTGG + Intronic
1112438697 13:99409645-99409667 GGGGACCTTGCTGACTGTGGAGG + Intergenic
1112438935 13:99411302-99411324 GGGGACCTTGCTGACTGTGGAGG - Intergenic
1114962735 14:27914462-27914484 GGGTACCATGCTGGAGGTAGAGG - Intergenic
1115641618 14:35339008-35339030 GGGTACAATGAGGCCTGTGTCGG - Intergenic
1116175978 14:41470844-41470866 GAGTACCATGGTGGCTGTCCTGG - Intergenic
1117508315 14:56424253-56424275 GGGTTCCAAGGTGGCTGGGGTGG + Intergenic
1118266281 14:64297512-64297534 AGGTAAGATGAGGGCTGTGGGGG - Intronic
1120375376 14:83697980-83698002 GGCTAGCATGATGGCTGGGTTGG + Intergenic
1121614025 14:95300762-95300784 GGATATAATGATGGCTGTGATGG - Intronic
1121676223 14:95755065-95755087 AGGTGCCATGATGGAGGTGGTGG + Intergenic
1121860076 14:97309091-97309113 AGGGACCATGCTGGATGTGGTGG - Intergenic
1122609089 14:102969136-102969158 GCGTGCCAGGATGGCTGGGGCGG + Intronic
1122839692 14:104451217-104451239 GGGCACCATGGGGGCTGTGGGGG - Intergenic
1125260146 15:37814157-37814179 TGATACCATGATTTCTGTGGTGG - Intergenic
1125457775 15:39878291-39878313 GGGTAGAATGATGGCTGTCAGGG - Intronic
1128759851 15:70209122-70209144 AGGTACCTGGATGGCTGAGGTGG - Intergenic
1129189983 15:73931528-73931550 TGGTCCCATGGGGGCTGTGGAGG - Intronic
1130710875 15:86279767-86279789 AGTTACCATGAGGGCTGTGTAGG - Exonic
1130870795 15:87970410-87970432 GGGTAGCGTGCTGGGTGTGGTGG + Intronic
1130904226 15:88228564-88228586 GGGAATCAGGAAGGCTGTGGTGG - Intronic
1131092345 15:89632266-89632288 TGTTACCATGATGGCTGGAGGGG - Intronic
1131790955 15:95965095-95965117 GGCTGTCCTGATGGCTGTGGTGG - Intergenic
1131815971 15:96221680-96221702 GGGTACAATGATGGTTGTCAGGG + Intergenic
1133802088 16:9092277-9092299 CGGTACCAAGATGGCGGCGGCGG - Intronic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1136724028 16:32342906-32342928 AGGAACCATGGTGGGTGTGGGGG + Intergenic
1136842361 16:33548950-33548972 AGGAACCATGGTGGGTGTGGGGG + Intergenic
1140179867 16:72704490-72704512 AGGTACCTTGGAGGCTGTGGTGG + Intergenic
1140716082 16:77726938-77726960 GTGTACCATCATGGCAGAGGGGG + Intronic
1140827805 16:78723963-78723985 GGGTACCATGGAGGCCATGGGGG - Intronic
1142161852 16:88561898-88561920 GGGGGCCATGATGGAAGTGGGGG + Intergenic
1203002403 16_KI270728v1_random:174859-174881 AGGAACCATGGTGGGTGTGGGGG - Intergenic
1203134008 16_KI270728v1_random:1711265-1711287 AGGAACCATGGTGGGTGTGGGGG - Intergenic
1203152526 16_KI270728v1_random:1849247-1849269 AGGAACCATGGTGGGTGTGGGGG + Intergenic
1143096220 17:4479966-4479988 GGGCACCATGATTTCTTTGGGGG - Intronic
1144150306 17:12436588-12436610 GAGTAGCAGGAAGGCTGTGGAGG - Intergenic
1144779597 17:17801181-17801203 GGGGTCTATGATGGCTTTGGGGG - Intronic
1145193483 17:20867572-20867594 GGCTACAATGCTGGCAGTGGGGG - Intronic
1145298538 17:21613508-21613530 GGCTACAATGCTGGCAGTGGGGG + Intergenic
1145901049 17:28490760-28490782 GGGCACCATCATGGCTGAGGTGG - Exonic
1146282304 17:31552616-31552638 GGCTACTATGATGGGTGGGGTGG - Intergenic
1147318504 17:39632433-39632455 AGGATCCATGAGGGCTGTGGGGG - Intronic
1149208467 17:54276731-54276753 GGATGCCAAGATGTCTGTGGAGG + Intergenic
1150265107 17:63827332-63827354 GGGAACCATGATGGGAGGGGCGG - Exonic
1153617634 18:6949157-6949179 TGGAACCATGCTGGATGTGGAGG - Exonic
1154466062 18:14643372-14643394 GGGAACCATGGCGGGTGTGGGGG - Intergenic
1155259257 18:24025665-24025687 GGGTGACATGATGACTGTAGTGG - Intronic
1156935685 18:42704043-42704065 GAGAACCATGGTGGCTGTGCTGG + Intergenic
1157217839 18:45800530-45800552 CAGCACCATGATGGCTGGGGAGG + Intergenic
1159369441 18:67512724-67512746 TGGTGCCATGATGGATGTGTGGG - Exonic
1160869640 19:1271392-1271414 GGGTACCGTGGTGGCTCTGCCGG + Exonic
1161804296 19:6433563-6433585 GGGTTCCAGGATGGGGGTGGAGG + Exonic
1161887190 19:7005949-7005971 TGGGACCAAGATGGCTGTGGAGG - Intergenic
1161888012 19:7011953-7011975 TGGGACCAAGATGGCTGTGGAGG + Intergenic
1162031040 19:7917352-7917374 GGGTCCCATCTTGGCTGTGGTGG + Intronic
1162805746 19:13137206-13137228 TGGTATCATGGGGGCTGTGGCGG + Intronic
1166009933 19:39934720-39934742 TGGGACCATGAAGGCTGAGGTGG + Intergenic
1166669454 19:44701255-44701277 GGGTACCAGGGTGGGTGTGGCGG - Intronic
1167767545 19:51493740-51493762 TGGAACCAAGATGGCAGTGGTGG - Intronic
1168149161 19:54435739-54435761 GGGGACCACGGTGGCAGTGGGGG + Intronic
925216819 2:2103600-2103622 GGGTGCCATGAGGGCTGTGCTGG - Intronic
925992306 2:9263345-9263367 GGGCACCAGGCTGGCTGGGGGGG + Intronic
926197687 2:10773668-10773690 GAGTACCAAGCTGGGTGTGGTGG - Intronic
927448366 2:23185501-23185523 GGGTGCCTTGGTGGCTGCGGTGG - Intergenic
929146006 2:38707523-38707545 GGGAACCTGCATGGCTGTGGTGG + Intronic
929955754 2:46457185-46457207 GCTTCCCATGTTGGCTGTGGTGG + Intronic
932267467 2:70380678-70380700 GGGTACCAAGATTGCTATGTGGG - Intergenic
934862248 2:97773970-97773992 GGGGACAGTGATGGCTGTGGAGG + Intronic
940423090 2:153501442-153501464 GGCTACCAGGAGGGCTGAGGTGG - Intergenic
941650066 2:168082921-168082943 GGTGAACATGATGGCAGTGGGGG - Intronic
942669598 2:178360195-178360217 GACTACCAGGATGGCAGTGGAGG + Intronic
942722071 2:178964605-178964627 TGCTACCACGATGGCTGTTGAGG + Intronic
942868087 2:180699784-180699806 GGGTGCCATGGGTGCTGTGGGGG - Intergenic
943923104 2:193736282-193736304 AGGTGCCATGATGGCTTTGAAGG - Intergenic
944067238 2:195632178-195632200 GGGCATGATGATGGGTGTGGTGG - Intronic
947865704 2:233396957-233396979 GGGGACCAGGGTGGCTGGGGGGG + Intronic
947865720 2:233397001-233397023 GGGGACCAGGGTGGCTGGGGGGG + Intronic
947865761 2:233397141-233397163 GGGGACCAGGGTGGCTGCGGGGG + Intronic
947865780 2:233397188-233397210 GGGGACCAGGGTGGCTGGGGGGG + Intronic
947865814 2:233397285-233397307 GGGGACCAGGGTGGCTGGGGGGG + Intronic
947865831 2:233397332-233397354 GGGGACCAGGGTGGCTGAGGGGG + Intronic
947865887 2:233397520-233397542 GGGGACCAGGGTGGCTGGGGGGG + Intronic
948137674 2:235648960-235648982 AGCTACCATGGTGGCTTTGGCGG - Intronic
948722314 2:239908817-239908839 AGGTGCCACGATGGCTGTCGTGG - Intronic
1169079393 20:2786719-2786741 GGAAACCATGGTGGCTGGGGTGG - Intergenic
1169945772 20:10986282-10986304 GGACACCATGAAGGCAGTGGGGG + Intergenic
1171164642 20:22959089-22959111 GCTCCCCATGATGGCTGTGGTGG - Intergenic
1171260169 20:23724992-23725014 GATTACCATGGTGACTGTGGTGG - Intergenic
1171481666 20:25459685-25459707 CGGTCCCAGGATGGCTGTGGGGG - Intronic
1173903722 20:46610528-46610550 GGGAAGCATCATGGCAGTGGAGG + Exonic
1176808523 21:13515224-13515246 GGGAACCATGGCGGGTGTGGGGG + Intergenic
1177396126 21:20538230-20538252 TGGTACCATGAAGGCAGAGGAGG - Intergenic
1178505651 21:33160843-33160865 GGTTCCCATGATGGTGGTGGTGG + Intergenic
1181801963 22:25353665-25353687 GGGTGCGATGAAGGCTGTGACGG + Intronic
1183145047 22:35982507-35982529 CTGTACCATGCTGGCTGTTGAGG - Intronic
1185279852 22:49965402-49965424 GGGTCCCATTTTGGCAGTGGGGG - Intergenic
952919748 3:38276300-38276322 GGTCACCATGCTGGCTGTGGTGG + Exonic
954802470 3:53195075-53195097 GATTACCATGATGGCTGCCGTGG + Intergenic
955376131 3:58398642-58398664 GGGTGCCAGCCTGGCTGTGGAGG - Intronic
955985032 3:64564146-64564168 TGGTGGGATGATGGCTGTGGGGG - Intronic
960367250 3:116787581-116787603 GAGTATCAGGATGTCTGTGGTGG + Intronic
960489467 3:118296674-118296696 GGGTACCATGATACCTTTAGAGG - Intergenic
966339767 3:178912682-178912704 GGGAACCCTAATGGCTTTGGAGG + Intergenic
967270925 3:187731773-187731795 GGGCAACATCATGGCTGTGATGG - Exonic
967828296 3:193896523-193896545 GGGTAAGATGATGGCTGGGTTGG - Intergenic
969290464 4:6235771-6235793 GGTTACGATGATGGGTTTGGGGG + Intergenic
971070650 4:23087761-23087783 GGGTACTATGATGGGTGGGATGG - Intergenic
972404588 4:38733911-38733933 GGTGACCATGGTGGTTGTGGTGG + Intergenic
973993895 4:56437199-56437221 TGATTCCATGATGGCTGGGGAGG + Intronic
974774649 4:66463458-66463480 GGGTTCCAAGATGGCTGAAGAGG - Intergenic
977938753 4:102835010-102835032 GGATACCCTGATGGCTCTGTGGG + Intronic
981156681 4:141445602-141445624 TGGTAAAATGATGGCTGTGGTGG + Intergenic
982788071 4:159559248-159559270 GAGTACCATGATGGCAGTTAAGG + Intergenic
984382709 4:179015673-179015695 TGGTACCAGGATGACTGGGGAGG + Intergenic
985483824 5:137762-137784 GGGCACCAATATGGCTGTGCTGG + Intergenic
986183562 5:5416577-5416599 AGCGACCATGATGGCTGTGGTGG + Intergenic
986190806 5:5494751-5494773 GGGTACCAGGATTGCAGGGGCGG - Intergenic
987776786 5:22377000-22377022 AGGTCCCATGATGCCTCTGGTGG - Intronic
989862722 5:46401091-46401113 GAGTGCTTTGATGGCTGTGGTGG + Intergenic
990008065 5:50965805-50965827 GGGTATCCTGGTGGCTGTCGGGG + Intergenic
991731427 5:69593228-69593250 TGGTTCCTTGATGCCTGTGGAGG - Exonic
991807859 5:70448383-70448405 TGGTTCCTTGATGCCTGTGGAGG - Intergenic
991863523 5:71034625-71034647 TGGTTCCTTGATGCCTGTGGAGG + Intergenic
991952484 5:71960048-71960070 TGCTGCCATGATGGCAGTGGGGG + Intergenic
996235696 5:121127052-121127074 GGGAAGCATGAAGGCTGAGGAGG - Intergenic
999803270 5:155057638-155057660 AGTTACTATGATGGCTGTGCTGG - Intergenic
1001422815 5:171600223-171600245 GGGTCCCATGATGGATGGGCAGG - Intergenic
1002724048 5:181282962-181282984 GGGAACCATGGTGGGTGTGAGGG - Intergenic
1202772446 5_GL000208v1_random:22690-22712 GAGCACTTTGATGGCTGTGGTGG - Intergenic
1006137892 6:31907310-31907332 GGGTACAAGGCTGGGTGTGGTGG + Intronic
1006449633 6:34098714-34098736 AGGTAACATGAAAGCTGTGGCGG + Intronic
1008876883 6:56338877-56338899 TGGTCCCATGATGGTTGGGGTGG + Intronic
1009601497 6:65806840-65806862 GGATACCAAGTTGGCTGTAGTGG + Intergenic
1009799353 6:68514382-68514404 TGGTACCTTGATTGCAGTGGTGG - Intergenic
1010687678 6:78871454-78871476 GGGTGTCATGGTGGCTGAGGTGG - Intronic
1012133091 6:95520165-95520187 GGGCTCCTTGATGGCAGTGGTGG - Intergenic
1019447557 7:1079261-1079283 GGGACCCAGGATGGCTGTGAAGG - Intronic
1019917536 7:4143442-4143464 GGGTGCCAGGAGGGCTCTGGGGG - Intronic
1023182293 7:37497001-37497023 GGCTACCAGGCTGGGTGTGGTGG + Intergenic
1023863068 7:44226998-44227020 GGGGACCAAGGTGGGTGTGGGGG + Intronic
1023863103 7:44227091-44227113 GGGGACCAAGGTGGATGTGGGGG + Intronic
1024000534 7:45186466-45186488 GGTCACCATGGTGGTTGTGGTGG + Intergenic
1024617537 7:51128282-51128304 GGATGCCAGGATGGCTGTGAGGG + Intronic
1025275820 7:57580626-57580648 GGCTACAATGTTGGCAGTGGGGG + Intergenic
1032159354 7:129498910-129498932 GGGTACCTAGATGGCTGCTGAGG + Intergenic
1033973615 7:147072639-147072661 GGGTTACATGTGGGCTGTGGTGG + Intronic
1034449841 7:151131489-151131511 GGGGAGCATGGTGGCGGTGGCGG - Intronic
1035542975 8:456492-456514 GGGGACCATGCTGGCTGCTGGGG + Intronic
1041692667 8:60704240-60704262 GGGCACCATGATGAGTGTTGGGG + Intronic
1042837657 8:73092702-73092724 GCGTACCTGGATGGCGGTGGTGG + Intronic
1046628546 8:116600985-116601007 GGAGACCATGTTGGCTCTGGAGG - Intergenic
1047166785 8:122448157-122448179 TTGTACCATGATAGCTGAGGTGG - Intergenic
1047746072 8:127845976-127845998 GGGTCCCAGGAAGGCTGTGCTGG + Intergenic
1048054519 8:130850637-130850659 GGGTACCTTGATAGAAGTGGAGG + Intronic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1053358057 9:37463930-37463952 GGTCACCAAGCTGGCTGTGGTGG + Intronic
1056587585 9:87938566-87938588 GGCTACAATGCTGGCAGTGGGGG - Intergenic
1056609286 9:88114373-88114395 GGCTACAATGCTGGCAGTGGGGG + Intergenic
1056655485 9:88505307-88505329 GGCTACCATGACGGATGAGGCGG - Intergenic
1057110074 9:92460964-92460986 AGGTACCAGGCTGGGTGTGGTGG - Intronic
1057379317 9:94554246-94554268 GGCTACAATGCTGGCAGTGGGGG - Intergenic
1060738522 9:126082064-126082086 GGGCTCCATGGGGGCTGTGGCGG + Intergenic
1061072739 9:128321621-128321643 GGGTACGCTGGTGGCTGTGAGGG + Exonic
1062707836 9:137955018-137955040 GGTCACCATGACGGCTGTGAAGG + Intronic
1185958302 X:4517487-4517509 AGGCACCATGATGGGTGTGTAGG - Intergenic
1186343560 X:8667817-8667839 GGGTAAGAGTATGGCTGTGGAGG + Intronic
1189226971 X:39421200-39421222 GTGAACCATGAAGGCTGTGGAGG + Intergenic
1190233878 X:48601539-48601561 GGGCAGCATGATGGCTCTGAAGG + Intronic
1191017601 X:55827095-55827117 GGGTACCAAGATGGCTGAATAGG + Intergenic
1198344609 X:135747367-135747389 GGGGACCATCATGATTGTGGAGG - Intergenic
1200493220 Y:3853184-3853206 TGGTACTTTAATGGCTGTGGGGG + Intergenic
1200988458 Y:9326971-9326993 GGGCACCATCAGAGCTGTGGTGG - Intergenic
1201018173 Y:9625391-9625413 GGGCACCATCGCGGCTGTGGTGG - Intergenic
1202119544 Y:21509221-21509243 GGGCACCATCAGAGCTGTGGTGG + Intergenic
1202121996 Y:21532761-21532783 GGGCACCATCAGAGCTGTGGTGG + Intronic
1202157010 Y:21896621-21896643 GGGCACCATCAGAGCTGTGGTGG - Intronic
1202159456 Y:21920162-21920184 GGGCACCATCAGAGCTGTGGTGG - Intergenic
1202185903 Y:22185077-22185099 GGGCACCATCAGAGCTGTGGTGG - Intergenic
1202205457 Y:22401319-22401341 GGGCACCATCAGAGCTGTGGTGG + Intronic