ID: 1136546695

View in Genome Browser
Species Human (GRCh38)
Location 16:30958505-30958527
Sequence CACCTCCCAACTCTACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136546695_1136546701 10 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546701 16:30958538-30958560 GGGTTGTTGTGGCGAAACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1136546695_1136546700 -1 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546700 16:30958527-30958549 GGAAAGAGGCTGGGTTGTTGTGG 0: 1
1: 0
2: 2
3: 33
4: 335
1136546695_1136546707 30 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546707 16:30958558-30958580 AGGGTACTTGGGGGAGAATCCGG 0: 1
1: 0
2: 2
3: 13
4: 187
1136546695_1136546704 19 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546704 16:30958547-30958569 TGGCGAAACAGAGGGTACTTGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1136546695_1136546699 -10 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546699 16:30958518-30958540 TTGGGAGGTGGAAAGAGGCTGGG 0: 1
1: 1
2: 2
3: 43
4: 518
1136546695_1136546705 20 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546705 16:30958548-30958570 GGCGAAACAGAGGGTACTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 122
1136546695_1136546706 21 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546706 16:30958549-30958571 GCGAAACAGAGGGTACTTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1136546695_1136546702 11 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546702 16:30958539-30958561 GGTTGTTGTGGCGAAACAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1136546695_1136546703 18 Left 1136546695 16:30958505-30958527 CCTGACAGTAGAGTTGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1136546703 16:30958546-30958568 GTGGCGAAACAGAGGGTACTTGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136546695 Original CRISPR CACCTCCCAACTCTACTGTC AGG (reversed) Intronic
900545994 1:3229524-3229546 CACCTCCCATCTTCCCTGTCAGG + Intronic
900971512 1:5994594-5994616 CACCCCCCAACTCCAGTGCCTGG - Intronic
901963279 1:12844530-12844552 GATCTCCCAACACTACTTTCAGG - Intergenic
901990476 1:13108863-13108885 GATCTCCCAACACTACTTTCAGG - Intergenic
902978660 1:20107758-20107780 CACCTCCCAAGCCTTCTCTCAGG - Intergenic
904059741 1:27699333-27699355 CTTCTCACAACTCTGCTGTCTGG + Intergenic
906683410 1:47746812-47746834 CACCTCCCATCTCTTCCGTGTGG + Intergenic
907268217 1:53275546-53275568 CTCCTCCCAACTCTGCCCTCTGG + Intronic
908176136 1:61556869-61556891 TACCTCCCAACTGTCCTGGCAGG - Intergenic
912014822 1:105019466-105019488 CAACTTCAAACTCTACTGTAAGG - Intergenic
917592336 1:176489317-176489339 CACCTCCCCACTCTAATGTATGG + Intronic
919052184 1:192525199-192525221 CACCTCAGATCTCTATTGTCTGG - Intergenic
920249768 1:204615797-204615819 CTCCTCCCCACTCTTCTGACGGG - Intergenic
923129708 1:231064829-231064851 CACAGCCCAACTCTACTTTAAGG - Intergenic
1063283614 10:4659579-4659601 CACCCCCCAACTCCACAATCTGG - Intergenic
1067827977 10:49593188-49593210 CACCTCCCTACACTGCTGCCTGG - Intergenic
1068384684 10:56310153-56310175 CACCTTCAAACTATACTGCCAGG + Intergenic
1069856590 10:71444424-71444446 CACCTCCCCAGTCTCCTGTCAGG - Intronic
1072451275 10:95541463-95541485 AACCTCCCAAGCCTACTGCCTGG + Intronic
1074522860 10:114240373-114240395 CTCCTCCCTTCTCTTCTGTCTGG - Intronic
1075526862 10:123194300-123194322 CACCTTCCAACTCTCCTGGGAGG + Intergenic
1076231456 10:128823055-128823077 AAACTCCAAGCTCTACTGTCAGG - Intergenic
1077481227 11:2815611-2815633 CCCCCTGCAACTCTACTGTCAGG - Intronic
1079738325 11:24025780-24025802 CACCTCCCAACTATATTTCCAGG + Intergenic
1085198966 11:74690001-74690023 CACCTCCGTCCTCTACTGTGAGG - Intergenic
1085345041 11:75763189-75763211 GACCTCCCAGCTCTAAGGTCAGG - Intronic
1088123328 11:106395025-106395047 CTGCTCCCAACTCTGCTCTCTGG - Intergenic
1088195590 11:107270290-107270312 AACCTCCCTTCTCTAATGTCAGG + Intergenic
1089397711 11:118146442-118146464 CACCTTCCAACCCCACTCTCAGG + Intronic
1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG + Intronic
1090641947 11:128737262-128737284 CACCTCACCACACTATTGTCAGG + Intronic
1093966340 12:25331123-25331145 CACTTTCCAACTATGCTGTCAGG - Intergenic
1094038285 12:26094418-26094440 CAGCTGCCAACTCTACACTCAGG + Intergenic
1094426884 12:30325222-30325244 CACCTCCCACCTATACCCTCTGG - Intergenic
1100294313 12:93246588-93246610 CACCTCACAACTCTACAGGCAGG + Intergenic
1101935613 12:109053685-109053707 CTCCTCCCAACTCTGCTATGAGG - Intronic
1104665619 12:130645493-130645515 CACCTTCCACCCCTACAGTCAGG + Intronic
1106080858 13:26499363-26499385 CACCTCCCAACGCTGCTGGAAGG + Intergenic
1111820515 13:93208059-93208081 CACATCCTTACTCTACCGTCAGG - Intergenic
1114055616 14:18965141-18965163 CAGCTCCCATCCCTCCTGTCAGG + Intergenic
1114106930 14:19436622-19436644 CAGCTCCCATCCCTCCTGTCAGG - Intergenic
1118419459 14:65585061-65585083 TGCCTCCCAACTCAACTGTTAGG + Intronic
1119407336 14:74407044-74407066 CTTCCCCCAACTCCACTGTCTGG - Exonic
1119777983 14:77259987-77260009 GTCCTCCCAGCCCTACTGTCTGG - Intergenic
1122312559 14:100806454-100806476 CTCCACCCAACTCCACTGTGAGG - Intergenic
1124614505 15:31231684-31231706 CCCCTCCCGACTCTACTCCCAGG + Intergenic
1129228263 15:74182262-74182284 CACCTCCCCACCCCACTGGCAGG - Exonic
1129743871 15:78004402-78004424 CACCTCCCAGCCCTCCTGCCTGG - Intronic
1130822162 15:87507258-87507280 CACCTTCCACCACTACTGTGAGG - Intergenic
1134453992 16:14380383-14380405 AACCTCCCAACTCTCCAGTCTGG + Intergenic
1135146722 16:19969127-19969149 CCCCTCCCATCTCCACTGACTGG - Intergenic
1135228963 16:20687056-20687078 CAACTCCCACCTCTTCTCTCAGG + Intronic
1135304023 16:21353719-21353741 ATTCTCCCAACTCTACTGTGGGG + Intergenic
1136300757 16:29332856-29332878 ATTCTCCCAACTCTACTGTGGGG + Intergenic
1136546695 16:30958505-30958527 CACCTCCCAACTCTACTGTCAGG - Intronic
1137254345 16:46762709-46762731 AACTTCCCAATTCTACTGTGTGG - Intronic
1145251967 17:21301683-21301705 CATCTCCCAACCTTCCTGTCAGG + Intronic
1146492825 17:33294230-33294252 CACCACCAAATTCTACTCTCCGG - Intronic
1147738487 17:42656159-42656181 TTCCTCCACACTCTACTGTCTGG - Intergenic
1149545654 17:57501671-57501693 CATCTCCCCTCACTACTGTCAGG + Intronic
1150793484 17:68219341-68219363 CACCTCTCACCTCTTCTGTCTGG + Intergenic
1151978413 17:77495256-77495278 CACCTCACAACTGTCCTGACAGG - Intronic
1152276936 17:79363443-79363465 GACTTCCAAACTCTTCTGTCTGG + Intronic
1152596961 17:81242489-81242511 CACCTCCAAACTCAGCTCTCAGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1163020275 19:14477860-14477882 CACCTCCCATCTCTCCTTCCAGG - Exonic
1163667027 19:18607983-18608005 CACCCCCCAACTCTCATTTCAGG - Intronic
1163694439 19:18756773-18756795 CACCACCCCACTCCACTATCGGG - Intronic
1164807822 19:31130393-31130415 CACATCACCACTCTGCTGTCGGG - Intergenic
1166202689 19:41248735-41248757 CAGCTCCAAACTCTCCTGTGGGG - Exonic
1166976267 19:46606897-46606919 CAGCCCCCAGCTCTGCTGTCAGG + Intronic
1168189833 19:54729942-54729964 CACCTCCAAACCCTCCTGTATGG + Intronic
1168328999 19:55555208-55555230 CACCTGCCAACTTTCCTGTCAGG - Intergenic
925996094 2:9294508-9294530 CTCCTACCAACTCTATGGTCTGG + Intronic
931382288 2:61764798-61764820 CACCCCCAAACACAACTGTCAGG - Intergenic
931694950 2:64864774-64864796 CTCCACCCAATTCTATTGTCAGG + Intergenic
932537011 2:72609056-72609078 CACTTCCCAACTCTACCCACAGG + Intronic
933087987 2:78080087-78080109 CACCACCCATCTTTACCGTCAGG - Intergenic
935690993 2:105732449-105732471 CACCTCCCAACTTTACTCTGGGG + Intergenic
936227295 2:110668340-110668362 CAAGACCCATCTCTACTGTCTGG + Intronic
938473782 2:131589716-131589738 CAGCTCCCATCCCTCCTGTCAGG + Intergenic
939430079 2:142093044-142093066 TACCTCCAAAGTCTCCTGTCTGG + Intronic
941769590 2:169330508-169330530 CACCTCTCACCTCTACAATCAGG + Intronic
946317309 2:218925213-218925235 CACCTTCCATCTCTTCTTTCTGG - Intergenic
1169508593 20:6240094-6240116 CACCTCCCAATTCTTGTCTCAGG + Intergenic
1173268033 20:41504759-41504781 CTCCTGCCAACTCTAATATCTGG + Intronic
1173366391 20:42389468-42389490 CACCTCCCAACACTGCTGCAAGG - Intronic
1174851826 20:54003024-54003046 CACCTCCCAGCTCCACTCACAGG + Intronic
1178286235 21:31327846-31327868 CTCCTCCCAACGCAGCTGTCAGG + Intronic
1178436889 21:32567641-32567663 CCCCTCCCAAGTCTTCTGCCTGG - Intergenic
1178534801 21:33403079-33403101 CCCCCCCCAACTCTCCTCTCGGG - Exonic
1180071679 21:45439986-45440008 CACCTCCCACCCCTTCTGTGGGG + Intronic
1180474092 22:15687693-15687715 CAGCTCCCATCCCTCCTGTCAGG + Intergenic
1184130235 22:42513121-42513143 CCCCTCCCAGCTCTGCTGTGGGG + Intronic
1184140411 22:42574944-42574966 CCCCTCCCAGCTCTGCTGTGGGG + Intergenic
1185201781 22:49511381-49511403 CACCTCCTAACACTACCGCCTGG - Intronic
949584526 3:5424939-5424961 CACCTCCCCACCCATCTGTCTGG + Intergenic
950628077 3:14263109-14263131 CACCTCTCAAGTCTCCTGCCTGG - Intergenic
952727356 3:36600977-36600999 CCACTCCCAACCCAACTGTCAGG + Intergenic
954620379 3:51992063-51992085 CACCTCCAAGCTCTGTTGTCTGG - Intergenic
955104990 3:55889300-55889322 CACCTCCCAGCTTTACATTCAGG + Intronic
956793391 3:72697568-72697590 CATCTCCCTATTTTACTGTCAGG + Intergenic
961813287 3:129533975-129533997 CTCCTCCCAACTCATCTTTCAGG + Exonic
963583212 3:147153009-147153031 CATTTCCCAACTCTTCTGTGAGG - Intergenic
966715671 3:183011054-183011076 GACCACCCTACTCTGCTGTCCGG + Intergenic
966847966 3:184145118-184145140 CACATCCCAACTCCACAGTCAGG - Exonic
967135511 3:186509654-186509676 CCCCTCCCAAGCCTACTCTCAGG - Intergenic
967945972 3:194804553-194804575 CACCTTCCATCTCTACATTCCGG - Intergenic
969307221 4:6332724-6332746 CACCTCCATTCTTTACTGTCCGG - Intronic
969435547 4:7187147-7187169 GACCTGCCAAATCCACTGTCTGG + Intergenic
971745000 4:30567708-30567730 CACCTCCCATCCCTAGTCTCTGG - Intergenic
978248377 4:106602951-106602973 AACCTCCCAAATTTACTTTCTGG + Intergenic
978334013 4:107646701-107646723 CCCCTCCCAACCCTGCTCTCAGG + Intronic
982143894 4:152360566-152360588 CTCCCCACACCTCTACTGTCTGG + Intronic
987435639 5:17890672-17890694 CACTTCCCAACTCTTCCATCTGG - Intergenic
990555469 5:56930441-56930463 CCCCTGCCACCTCTACTTTCTGG - Intronic
992401005 5:76411481-76411503 CACCTCCCAACACTACTGCATGG - Intronic
995176055 5:109178549-109178571 CACCTCCCAACTCTAGTCAGTGG - Intronic
997159976 5:131597690-131597712 CACCTCCCCACTCCAGTCTCTGG - Intronic
998253312 5:140567014-140567036 CATCTACCAACTCCACAGTCAGG - Exonic
998600012 5:143575872-143575894 CACCTGCCAACTTTGCTGGCTGG + Intergenic
999200970 5:149816006-149816028 AACCTCCCAGCTCCACTGGCAGG + Intronic
1000877406 5:166657889-166657911 CACCTCCCAATTGCACTATCTGG - Intergenic
1001759644 5:174196743-174196765 TATCTCACAGCTCTACTGTCAGG - Intronic
1002469282 5:179425775-179425797 CACCTCCCAAGGGTGCTGTCAGG - Intergenic
1003364230 6:5457248-5457270 CACCTCCCACCCCTATGGTCAGG + Intronic
1007391375 6:41551408-41551430 CACCTTCCTTCTCTCCTGTCTGG + Intronic
1008680442 6:53866258-53866280 CACCTCACAAGTCTACTGAGAGG - Intronic
1010666161 6:78632067-78632089 CACCTCCCTCCTCTCCTGTGGGG - Intergenic
1019267598 7:127132-127154 CACATCCCAACTCCACTGCCTGG + Intergenic
1019570343 7:1708527-1708549 CACCTCCCACCCCAACTGCCTGG - Intronic
1022528471 7:31052904-31052926 CACCCCCCAACCCAAGTGTCTGG + Intronic
1023802957 7:43850827-43850849 AACTTCCCAACTCCACTTTCAGG + Intergenic
1024469443 7:49752165-49752187 TGCTTCTCAACTCTACTGTCTGG + Intergenic
1024557404 7:50615386-50615408 GACCTCCCAGCTCTGCTGTGTGG - Intronic
1026153801 7:67810274-67810296 TACCTCCCAAGTCTACAGGCTGG - Intergenic
1029480255 7:100807970-100807992 CACCTCACAACTCACCTGTAGGG + Intronic
1032023198 7:128421514-128421536 CACCTCCCCACCCTACTTCCAGG + Intergenic
1033199501 7:139356685-139356707 AACCACCCAACTCTATTGTGGGG + Intronic
1033818892 7:145109558-145109580 CACCTCCCAACACTGTTGTATGG - Intergenic
1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG + Intergenic
1034410932 7:150941844-150941866 CACCTTCCAGCTCCACTCTCAGG + Intergenic
1035326002 7:158066468-158066490 CACCTCCCAACTCCTCAGTATGG + Intronic
1035448984 7:158962949-158962971 CACCTCCCACCCACACTGTCTGG - Intergenic
1039032625 8:33326694-33326716 GACCTCCCATCTCTAAAGTCAGG - Intergenic
1039476795 8:37843029-37843051 CACCTCTGAACCCTGCTGTCTGG - Exonic
1044543466 8:93433323-93433345 CATGCCCCAAATCTACTGTCAGG - Intergenic
1046691904 8:117295233-117295255 CCACTCCCAGGTCTACTGTCTGG - Intergenic
1049024897 8:139981634-139981656 CAGCCCCCAACTCAACTATCTGG - Intronic
1049274233 8:141711674-141711696 CACCCCCCTACTCTTCTCTCTGG + Intergenic
1053483748 9:38436526-38436548 CTCCTCCCACCTCTACTGATCGG - Intergenic
1055948040 9:81709390-81709412 CCTCTCCCAAATCTACTGCCAGG - Intergenic
1056895784 9:90548162-90548184 TGCCTCCCAACCCTACTCTCAGG + Intergenic
1061563157 9:131419667-131419689 CACCTCCCAGGTCTGCTGTAAGG - Intronic
1187332761 X:18355219-18355241 CACCTCCCAGCTTCACTCTCTGG + Intergenic
1192396847 X:70790692-70790714 CACCTCCCAAGGCTCCTGCCTGG + Intronic
1193302452 X:79905701-79905723 CAGCTCCCACCTCTACCCTCTGG - Intergenic
1193593447 X:83418841-83418863 TCCCTGCCAACTCTAGTGTCAGG - Intergenic
1195364199 X:104112015-104112037 CACTTCCTAACTGTACTGCCTGG + Intronic
1196627012 X:117888107-117888129 CTCTTCCCAACTCCACTTTCAGG + Intergenic
1200174686 X:154105368-154105390 CAGCTCCCAGCTCAGCTGTCTGG - Intergenic