ID: 1136549123

View in Genome Browser
Species Human (GRCh38)
Location 16:30972942-30972964
Sequence GCACATCTGCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136549116_1136549123 7 Left 1136549116 16:30972912-30972934 CCAGGAAGAGGCACAGGGCAGCC 0: 1
1: 0
2: 7
3: 50
4: 438
Right 1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG 0: 1
1: 0
2: 4
3: 37
4: 441
1136549112_1136549123 19 Left 1136549112 16:30972900-30972922 CCATGAGAAGCACCAGGAAGAGG 0: 1
1: 0
2: 2
3: 40
4: 347
Right 1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG 0: 1
1: 0
2: 4
3: 37
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136549123 Original CRISPR GCACATCTGCAGGAGGAGGA AGG Intronic
900403586 1:2482844-2482866 GCACATCTGCAGGCCGAGGCGGG + Intronic
900499844 1:2998646-2998668 ACACAGCTGGAGCAGGAGGAGGG + Intergenic
900955084 1:5881807-5881829 GCTCGTCTGCAGGAGGTGGCAGG - Intronic
901287354 1:8091494-8091516 GCACATCTGTAGTAGGTGGGAGG - Intergenic
901815632 1:11791868-11791890 GAACATGAGCAGGAGGAGGCGGG - Intronic
902043745 1:13510642-13510664 GCACAAATGCAGGAGGAGGAGGG + Intronic
902781184 1:18705948-18705970 GAACAGCTGCTGGAGGAGGGCGG + Intronic
902971304 1:20053707-20053729 CTAAATCTGCAGGAGGAGAAGGG - Intronic
902991726 1:20192377-20192399 GAACCTCTGGAGGAGGAGGGGGG + Exonic
903330633 1:22595306-22595328 GCTCATCTGCAAGAAGAGGTGGG + Exonic
903812394 1:26041962-26041984 TCACATCTGCAAGAGCAGAAAGG + Intronic
904340596 1:29831703-29831725 TGACATCTGCGGGAGCAGGAGGG + Intergenic
904379550 1:30101710-30101732 GAAAGTCTGCAGGATGAGGACGG - Intergenic
904402274 1:30264559-30264581 GCAGATCTGCTGGCAGAGGAAGG + Intergenic
904464779 1:30701322-30701344 CTCCATCTTCAGGAGGAGGAAGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906860611 1:49355023-49355045 GCACATCTTTGGGATGAGGAAGG + Intronic
907680152 1:56555402-56555424 TCACTTATGCAGGAGAAGGAAGG + Intronic
910501991 1:87902981-87903003 ACACATCTTCAGGAGGAGGAAGG + Intergenic
910657063 1:89630600-89630622 GCACATCTCCAGGAAGGAGAGGG - Intergenic
913066207 1:115257729-115257751 CCACATCTTAAGGAGTAGGAGGG + Intergenic
913103620 1:115592723-115592745 CCACCTGTGCAGTAGGAGGATGG + Intergenic
913996527 1:143655224-143655246 GCACATTTCTAGGAAGAGGAAGG - Intergenic
915443038 1:155958391-155958413 GCACATCTGGAAGGGGATGAAGG + Exonic
916274502 1:162979055-162979077 GCACTTCTGGAGGCGGAGGGGGG - Intergenic
917907816 1:179605466-179605488 GCACCTGTTCAGGAGGAGGTGGG + Intronic
918520479 1:185409523-185409545 CCACACCTGCCGGTGGAGGAGGG - Intergenic
919354067 1:196499063-196499085 ACACATATGCAGAAGGAAGATGG + Intronic
919982202 1:202649120-202649142 GCACATCAGCAGGAGGAGCAGGG + Intronic
920041741 1:203102384-203102406 GCACATGTGGAGGAGGGGGAAGG - Intronic
920571746 1:207022956-207022978 GCAACCCTGCAGGAGGAGGCTGG + Exonic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
922803364 1:228373915-228373937 CCAGACCTGCAGGAGGAAGAGGG - Exonic
922917063 1:229267333-229267355 GCACAGATGCTGGGGGAGGATGG + Intergenic
923130571 1:231071348-231071370 GCACATCTGGAGGGGGATGGAGG - Intergenic
923766913 1:236901052-236901074 GAGAATCTGGAGGAGGAGGAGGG + Exonic
924441134 1:244086405-244086427 GCATCTCTGTAAGAGGAGGAAGG - Intergenic
924456143 1:244220125-244220147 GCTCATCTGCAGGTTCAGGAAGG + Intergenic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
1064797649 10:19031401-19031423 TCACTTCTGCTGGAGGACGAAGG + Intergenic
1064922439 10:20533360-20533382 GAAAATCTGCAGGATGGGGATGG - Intergenic
1067828571 10:49597028-49597050 CCACAGCAGCAGGAGCAGGAGGG - Intergenic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1069062061 10:63904663-63904685 GCACTGCTGGAGGAGTAGGAGGG + Intergenic
1069848757 10:71391371-71391393 GACCAGCTGCAGGAGGAAGAGGG - Intergenic
1070158131 10:73848952-73848974 GCAGATCAGGAAGAGGAGGAAGG + Intronic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071566464 10:86673801-86673823 GCACATCTAGAAGAGGAGGAAGG + Intronic
1072245815 10:93542933-93542955 GCAGATTTGCAGGAGAGGGAAGG + Intergenic
1073915138 10:108394206-108394228 GCACAGGGGCAGGAGGAGTATGG + Intergenic
1074301121 10:112234215-112234237 GCAGATGTGGGGGAGGAGGAGGG - Intergenic
1074493017 10:113955754-113955776 CCACATCTGCGGGAGCAGGAAGG - Intergenic
1074710695 10:116175135-116175157 GCACATCACCAGGAAGACGAAGG + Intronic
1075336361 10:121611791-121611813 GCACCTCTGTAGCAGGAGGTTGG - Intergenic
1076043509 10:127272034-127272056 TCACAACTGCAGGAGGATGGAGG + Intronic
1076518152 10:131061718-131061740 CCAGCTCTGCAGGAGGAGGATGG - Intergenic
1077025349 11:437603-437625 GCATATCTGTCGGAGGATGAAGG - Intronic
1077130953 11:972274-972296 GCACATCTTCAGCAGGAGCCCGG - Intronic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1077941193 11:6845546-6845568 GCACCTCAGCTGGAAGAGGAAGG - Intergenic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1078437628 11:11338575-11338597 GCAGATCTGGAGGAAGAAGATGG + Intronic
1080692071 11:34566576-34566598 GTACATCTGCAGGTGGAAGAAGG - Intergenic
1081407274 11:42712228-42712250 TCACCTCTGCATGATGAGGATGG - Intergenic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1083162691 11:60865035-60865057 GCAGAGCTGGAGGAGGAGGGAGG - Intergenic
1083578934 11:63813068-63813090 GGGCATCTGCTGGCGGAGGAAGG + Intergenic
1083643836 11:64160562-64160584 GCACTTTTGCAGGCGGAGGTGGG + Intronic
1083856019 11:65393556-65393578 GCACCTCTGCAGGACGAGATGGG - Exonic
1083882467 11:65555335-65555357 GCACATTTGCAAGAGGGAGATGG - Intronic
1083896093 11:65620541-65620563 TCAGATCTGCAGGGAGAGGATGG + Intronic
1084069731 11:66726697-66726719 GCAGATATGCGGGAGGAGAACGG + Intronic
1084399881 11:68937341-68937363 GCATGTCTGCAGCAGCAGGAGGG + Intronic
1085019040 11:73193539-73193561 GAACAGCTCCATGAGGAGGAGGG - Intergenic
1085815514 11:79733110-79733132 GCACATATGTGGGTGGAGGATGG - Intergenic
1087093981 11:94303021-94303043 GCGCATATGCAGGTGGAGGGAGG - Intergenic
1087496451 11:98896022-98896044 GAAAATTTGGAGGAGGAGGAAGG + Intergenic
1088779827 11:113123558-113123580 GCACATCTCCAGAGAGAGGATGG - Intronic
1088952436 11:114585187-114585209 CCAGTTCTGCAGGTGGAGGATGG + Intronic
1088952438 11:114585225-114585247 CCAATTCTGCAGGTGGAGGATGG - Intronic
1090567636 11:128012717-128012739 GTACATGTGCAGGAGGTGCAGGG - Intergenic
1090993895 11:131847491-131847513 GCCAACCTGCAGGAGGAGGCAGG + Intronic
1091404260 12:199128-199150 ACACATCAGCAGGGGGAGGGTGG + Intronic
1091662400 12:2394228-2394250 CCACATCAGGAGTAGGAGGAGGG - Intronic
1092257254 12:6934159-6934181 TGACATCTACAGGAGGAGGAAGG - Exonic
1092795420 12:12106387-12106409 TCACTTCAGCTGGAGGAGGAGGG - Intronic
1092883580 12:12906756-12906778 ACACATCTTAAGGAGGAGGCCGG + Intronic
1092942951 12:13427634-13427656 GGACCTCTGCAGCAGGAGGCTGG + Intergenic
1093795682 12:23307775-23307797 GTCCATCACCAGGAGGAGGATGG - Intergenic
1094199142 12:27779869-27779891 GCGCAGCTGCGGGAGGCGGAGGG - Intergenic
1094563342 12:31576634-31576656 GCACTTTTGTAGGATGAGGAGGG + Intronic
1094842947 12:34349569-34349591 GCGCATGTGCAGCAGGGGGAGGG + Intergenic
1096536343 12:52277540-52277562 CCAGCTCTGCAGGAGGAGGGTGG + Intronic
1097151601 12:56983448-56983470 GAACAGGTGCAGGAGGATGAGGG + Intergenic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1097710761 12:62914530-62914552 GCACATCTGTGGGAGAGGGAAGG + Intronic
1099764275 12:86961677-86961699 GCACAGCTGAAGATGGAGGAGGG + Intergenic
1100535492 12:95505012-95505034 GCACAGATGAGGGAGGAGGATGG - Intronic
1101097652 12:101359772-101359794 GCACAGCTGCAGGAGGCACATGG - Intronic
1101660902 12:106764821-106764843 GCAGATCTGGATGAGGAGGATGG + Intronic
1102220855 12:111193585-111193607 GCACATCTGCTGGATAAAGACGG + Intronic
1102954218 12:117048924-117048946 GCGCCTCTGCAGCAGGAGGCTGG - Intronic
1103323247 12:120103644-120103666 TCACATCTTCAGGACCAGGAAGG + Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG + Intronic
1104575933 12:129965843-129965865 GAACATCAGCAGGAACAGGATGG + Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1105542140 13:21325090-21325112 GCACATTGGCAGGAGGAATAAGG - Intergenic
1106119457 13:26847434-26847456 TCACCTCTGCTGGAGGGGGAGGG + Intergenic
1106406627 13:29480302-29480324 GCGCGCCTGCAGGAGGAGCACGG + Exonic
1106548191 13:30748776-30748798 GCTCATCTACAAGAGGTGGATGG - Intronic
1107527342 13:41246189-41246211 GCATCTGTGCAGGAGGAAGAAGG - Intronic
1108200899 13:48042005-48042027 GGGCAGCTGCATGAGGAGGACGG + Intronic
1108256862 13:48619363-48619385 CCACATGTGCATCAGGAGGATGG + Intergenic
1109061902 13:57631391-57631413 GCACATTTAAAGGAGGAGGGGGG - Intergenic
1109322001 13:60822367-60822389 GCAAAGTTGCAGGTGGAGGAGGG + Intergenic
1113526104 13:110978609-110978631 GCACATCTGGAAGATGTGGAAGG - Intergenic
1113814481 13:113161762-113161784 GGACCTGAGCAGGAGGAGGACGG - Intronic
1113814508 13:113161846-113161868 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814537 13:113161930-113161952 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814588 13:113162098-113162120 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814629 13:113162224-113162246 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814808 13:113162770-113162792 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814828 13:113162846-113162868 GCACCTGAGCAGGAGGAGGGTGG - Intronic
1113814846 13:113162901-113162923 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113871850 13:113564679-113564701 GAGCATCTGAAGGAAGAGGAGGG - Intergenic
1114363190 14:21998535-21998557 GCACTTGTGGAAGAGGAGGAAGG + Intergenic
1115961360 14:38838175-38838197 GCGCCTCTGCACCAGGAGGAAGG + Intergenic
1117028171 14:51642701-51642723 GCATTTCTGTAGGAGGAAGATGG + Intronic
1117176414 14:53151852-53151874 GCACGTCTTCTGGAGTAGGAAGG - Intronic
1118279773 14:64418007-64418029 GCCCATCTGGATGAGGAGGTAGG + Exonic
1118347108 14:64948400-64948422 GCAGAGCTGGAGGAGGAGGAGGG - Exonic
1118404286 14:65408382-65408404 GCCCAACTGCAAGGGGAGGAGGG + Intergenic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119317831 14:73710162-73710184 GTACATGTGGAGCAGGAGGAGGG + Intergenic
1119613109 14:76080361-76080383 GCACATTTGGAGGAGGGGGTTGG + Intronic
1119672495 14:76530176-76530198 GCAGAACTGTAGGAGCAGGAAGG - Intergenic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1120662396 14:87265997-87266019 GGAAATCTGCAGGAGGAGAAGGG + Intergenic
1121667000 14:95680174-95680196 GCACCTCTGAAGGAGGAAGCTGG - Intergenic
1122543288 14:102509466-102509488 GCGCGTGTGCCGGAGGAGGAGGG + Intronic
1122939985 14:104976945-104976967 GCACAGCAGCGGGAGGATGATGG - Intronic
1123159126 14:106260418-106260440 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123190085 14:106560972-106560994 ACACGCCTGCAGTAGGAGGAAGG - Intergenic
1123207871 14:106730794-106730816 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123681265 15:22765822-22765844 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124195373 15:27621492-27621514 GAACTTCTGGAGCAGGAGGATGG - Intergenic
1124333476 15:28840284-28840306 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124532596 15:30520493-30520515 GCACAGCTGAAGGATGCGGAGGG - Intergenic
1124594774 15:31083433-31083455 GCACAGCTGCAGGTGGCGGCGGG + Intronic
1124766057 15:32487151-32487173 GCACAGCTGAAGGATGCGGAGGG + Intergenic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1126045890 15:44639455-44639477 GCACTTCTGAAGGTCGAGGAGGG + Intronic
1126293729 15:47112770-47112792 GCACATGTGCATGGGGAGGAGGG + Intergenic
1128221816 15:65974686-65974708 CCACACCTCCAGGAGGAAGAAGG - Intronic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129530345 15:76260083-76260105 GCCCAGCTGAAGCAGGAGGATGG - Intronic
1130204814 15:81865980-81866002 GCACATCAACAGGAGAATGAAGG + Intergenic
1130320950 15:82840680-82840702 GCACTTCTGGAGGCGGAGGCAGG - Intronic
1130438322 15:83925172-83925194 GCCCATCTCCAGGATGTGGAGGG - Intronic
1130868874 15:87954391-87954413 ACACATCTGCAGGAGGCAGGAGG - Intronic
1130934636 15:88458589-88458611 GCACACATGCAGGAGGAAAAAGG + Intergenic
1131256363 15:90865198-90865220 GCACCTCTGGAGGGGGAGGCAGG + Intergenic
1132647418 16:1005393-1005415 GCACAGCTGAAGGAAGAAGAAGG - Intergenic
1132679966 16:1135814-1135836 GCACCTCGGCAGGTGGAGGCAGG - Intergenic
1132843681 16:1990383-1990405 GCCCACCTGCGGGCGGAGGAGGG + Intronic
1133344448 16:5060507-5060529 GCAGGGCTGCAGGAGGAGGTGGG - Intronic
1134162351 16:11901847-11901869 GCACTTCTGGAGGTGGAGGCGGG + Intronic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138489303 16:57366874-57366896 GCACTCCTGCAGGACCAGGATGG - Intergenic
1139272629 16:65698220-65698242 GCACTTTTGGAGGCGGAGGAGGG + Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1139470762 16:67176970-67176992 GGACACCTGCAGGAGGAAGCCGG + Exonic
1141099431 16:81186223-81186245 GCAAATCTGCAGGATGTGGTTGG + Intergenic
1141393093 16:83680948-83680970 GCACATCTGTAGAGGGAAGAGGG + Intronic
1142007624 16:87697215-87697237 GCACACCTGAGGGAGGGGGAGGG + Exonic
1142102843 16:88284767-88284789 GCAGCTCTGCAGGAGGGCGATGG + Intergenic
1142149796 16:88507656-88507678 CCACATCTGCCGGAGCTGGATGG - Intronic
1142195604 16:88737985-88738007 GCACAGCAGCAGGAGGACGCCGG + Exonic
1142814132 17:2412149-2412171 GCACTTCTGGAGGCCGAGGAGGG - Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143347785 17:6262528-6262550 GCACCTACGCAGGGGGAGGAGGG + Intergenic
1143672629 17:8406929-8406951 GCACATCTGCGGCGGGAGGAGGG - Intergenic
1143840805 17:9730271-9730293 GCACTTTGGCAGGCGGAGGAAGG + Intergenic
1145863609 17:28226840-28226862 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1146675859 17:34773431-34773453 GCCCAACTGCAGCAGCAGGAGGG + Intergenic
1147266914 17:39239991-39240013 GCACATCTGCAGGCACAGGGTGG - Intergenic
1147724043 17:42555432-42555454 GGGCATCTGCAGGAGGAGTTAGG + Intergenic
1148192964 17:45692687-45692709 GCCCTTCTCCAGGAGGAAGATGG + Intergenic
1148218400 17:45846375-45846397 GCCCATCTGCATGAGGACCATGG - Exonic
1148683227 17:49486474-49486496 GAACATCCGCAAGGGGAGGAGGG - Intergenic
1148917702 17:50996611-50996633 GCACATGTTCAGAAGGAAGACGG - Exonic
1149606009 17:57925755-57925777 GCAAATGTGAAGGAGGAAGAGGG + Intronic
1150124985 17:62629574-62629596 GCAGCTGAGCAGGAGGAGGATGG + Intronic
1151917568 17:77129670-77129692 GCAGAGCTGAAGGTGGAGGAGGG + Intronic
1152185886 17:78856078-78856100 GCACACCTGCAGTAGGAGGGGGG - Intronic
1152480999 17:80552494-80552516 TCACATCTCCAGGAGGAAGTAGG - Intronic
1152536613 17:80953765-80953787 GCACAGCTGCAGCAGGAGCTGGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152727946 17:81956841-81956863 GCAAAGCTGCAGCACGAGGACGG + Intronic
1155577073 18:27259587-27259609 ACACACCTGCAGGAGGTGGCTGG + Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156405543 18:36779287-36779309 GCACTTCAGCAAGAGCAGGAAGG + Intronic
1156957720 18:42988845-42988867 GCAGAGCTGCAAGAGGTGGATGG + Intronic
1157409013 18:47448171-47448193 GTACAACTGCAGGACCAGGAAGG + Intergenic
1157442670 18:47722473-47722495 ACACCTCTGCAGGTAGAGGAAGG + Intergenic
1157470458 18:47984258-47984280 GGCCAACTGCAGGAGGAGGAAGG + Intergenic
1158832848 18:61299335-61299357 ACACATGGGCAGGAGGAGAATGG + Intergenic
1159274225 18:66194278-66194300 GCAGATCTACAGAAGGAGGGTGG - Intergenic
1160439593 18:78879262-78879284 GCCCATGTGCGGGACGAGGAAGG + Intergenic
1160946542 19:1646422-1646444 GAACATCTGCAGGGAGGGGAGGG + Exonic
1161979027 19:7620997-7621019 GCACAGCTGGAGGAGGAGTGGGG - Exonic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1163324338 19:16593434-16593456 GCAGACCTGCAGGTGGAGGCTGG - Intronic
1163329980 19:16629881-16629903 GCACTTCAGCAGGCGGAGGTGGG + Intronic
1163882876 19:19942741-19942763 GCATTTCAGCAAGAGGAGGAAGG + Intergenic
1163918687 19:20266866-20266888 GCACTTTGGCAAGAGGAGGAAGG + Intergenic
1163930315 19:20384066-20384088 GCACTTTAGCAAGAGGAGGAAGG - Intergenic
1164562003 19:29299085-29299107 GCACTTCTGCAGGTGCAGGGAGG - Intergenic
1164706821 19:30325936-30325958 GCACATCTGCGGGTGTGGGAGGG - Intronic
1166275561 19:41751175-41751197 GGACATCAGCAACAGGAGGAGGG - Intronic
1166497125 19:43311694-43311716 GCACAACAGTAGGAGAAGGAAGG + Intergenic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1168246057 19:55113681-55113703 GCCCATCTGGAGGAGGCGGGAGG + Intronic
1168707756 19:58479631-58479653 CCACATCCGCAGGAGGAGTGGGG + Exonic
925097794 2:1220992-1221014 GCACATCTGTTGGATGGGGAGGG - Intronic
925498312 2:4477275-4477297 TCACATCTGCAGGAGGAACATGG + Intergenic
925912407 2:8582435-8582457 GCACAACTGCAGGAGAAAGGAGG + Intergenic
925947638 2:8880404-8880426 GAACAGATGCGGGAGGAGGAAGG + Intronic
926312085 2:11682174-11682196 GCTCACCTGCAGGAGGAGTGGGG - Intronic
927183951 2:20468721-20468743 GCCCTTCTACAGGGGGAGGAAGG + Intergenic
927284754 2:21345090-21345112 GGAATTCTGCAGGAGGAGGAAGG + Intergenic
927692297 2:25216536-25216558 GCACTTTTGGAGGACGAGGAGGG + Intergenic
928155827 2:28875646-28875668 GATCTTCTCCAGGAGGAGGAAGG - Intergenic
929504827 2:42520395-42520417 GCACAACTGAAGCAGGTGGATGG - Intronic
930798531 2:55419348-55419370 AGGCATCTGGAGGAGGAGGAAGG + Exonic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
932569805 2:72932638-72932660 GAACAGATGCTGGAGGAGGAGGG + Intronic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933091217 2:78119827-78119849 GAAAATCTGAAGGAAGAGGAGGG + Intergenic
933696425 2:85222093-85222115 GCACTTCTGGAGGCCGAGGAGGG + Intronic
933942273 2:87254564-87254586 ACACATCTGCAGGAAAAGCAGGG - Intergenic
935844960 2:107155678-107155700 GCACTTTTGGAGGTGGAGGAGGG - Intergenic
936337952 2:111607005-111607027 ACACATCTGCAGGAAAAGCAGGG + Intergenic
936930676 2:117785404-117785426 GCACTTCTGGAGGCTGAGGAAGG + Intergenic
937397979 2:121555495-121555517 GCAAATTTTGAGGAGGAGGATGG + Intronic
938082738 2:128378866-128378888 GCTCACTTCCAGGAGGAGGAAGG + Intergenic
938605908 2:132892423-132892445 GCACATCTGGTGGTGGGGGATGG - Intronic
939800044 2:146697263-146697285 CCACATGTGCATTAGGAGGATGG - Intergenic
940081178 2:149803047-149803069 GCACTTCTGCAGGAGGAGGCTGG - Intergenic
940868179 2:158837642-158837664 GCACTTCAGGAGGTGGAGGAAGG + Intronic
941183580 2:162291633-162291655 TGACCTCTGGAGGAGGAGGAAGG + Intronic
941594673 2:167461030-167461052 CCACTTCAGCTGGAGGAGGAAGG + Intergenic
941680783 2:168396515-168396537 GCACATGTTCTGGAGGAGGAAGG - Intergenic
945184390 2:207124399-207124421 GCATGTCTGCAAGAGGAAGAAGG + Exonic
946314142 2:218898284-218898306 GCAGACCCGCAGGCGGAGGAGGG - Intronic
948575015 2:238944204-238944226 GCAGGGCTGCAGGGGGAGGAAGG + Intergenic
948663448 2:239520512-239520534 TCAAATCTGCAGGAAGGGGAAGG - Intergenic
948786108 2:240353779-240353801 GCACATCTGCAGGATGCGGCTGG - Intergenic
948858176 2:240740292-240740314 TCACACCTGGTGGAGGAGGAAGG + Exonic
1169058152 20:2640938-2640960 ACACATCTGTTGGAGGAGTATGG - Intronic
1171095782 20:22331322-22331344 GCAAATCTGCTCAAGGAGGAAGG - Intergenic
1171130967 20:22652648-22652670 GCACACAAGCACGAGGAGGAAGG + Intergenic
1171424623 20:25041897-25041919 GGTCACCTGCATGAGGAGGAAGG + Intronic
1171458495 20:25285264-25285286 TCACAACTGCAGGAGGAAAATGG - Intronic
1172107745 20:32526936-32526958 GCCCCTCTGCAGGGTGAGGAGGG + Intronic
1172782951 20:37447942-37447964 GCACAGCTGCAGGATGAGAGGGG - Intergenic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173371112 20:42436697-42436719 GCACATATACAGGAGAAGGTAGG + Intronic
1173621577 20:44440970-44440992 GCACTTCGGGAGGCGGAGGAGGG + Intergenic
1173819449 20:46011126-46011148 GAACCACTGCAGGAGGAGGGGGG - Exonic
1174800929 20:53562655-53562677 GCACTTCTGCAGGCCGCGGAGGG - Intergenic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1175583882 20:60122050-60122072 TCACATCTGCTGGGGGAGAACGG - Intergenic
1175624968 20:60482406-60482428 GCTCATCTGTAAGAGGTGGACGG - Intergenic
1177326394 21:19595368-19595390 GCACTTCCGGAGGTGGAGGAGGG + Intergenic
1177421263 21:20860868-20860890 GCACATGTGCAAGATGAAGAAGG + Intergenic
1177520339 21:22213687-22213709 GCACACCAGCAGAAGGAAGAAGG - Intergenic
1178070511 21:28960822-28960844 GAACTTCAGGAGGAGGAGGAGGG - Intronic
1178150947 21:29793107-29793129 AAACATATTCAGGAGGAGGATGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1180148754 21:45936867-45936889 GAAGATCCCCAGGAGGAGGATGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181844975 22:25699611-25699633 GCACAGCTGTGGGAGGAGGGAGG - Intronic
1182092552 22:27605698-27605720 GAACATATTCAGGAGAAGGATGG + Intergenic
1183271455 22:36865087-36865109 GCAGCTCTGCAGCAGCAGGACGG - Intronic
1183371275 22:37433801-37433823 GGAGAGCTGGAGGAGGAGGAAGG + Intergenic
1183500005 22:38173177-38173199 GCACAGCTGCAAGAGGGGGATGG + Intronic
1184114268 22:42413106-42413128 GCTCAGCTGCTGGAGAAGGAGGG - Intronic
1184538241 22:45102070-45102092 GCAGATGTGATGGAGGAGGAAGG - Intergenic
1184599473 22:45534026-45534048 GCTCATCTGCAGGAGGGAGGTGG + Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1184803192 22:46774845-46774867 GCACATGAGAAGGAAGAGGATGG - Intronic
1184935392 22:47716851-47716873 GCCCGTGTGCAGAAGGAGGAAGG + Intergenic
1185034219 22:48462912-48462934 GCACATCTGGAGGCTGAGGCGGG + Intergenic
949739587 3:7215416-7215438 GCACTTTTGGAGGCGGAGGAGGG + Intronic
950096979 3:10336129-10336151 GCCCGGCTGCAGCAGGAGGAAGG + Intronic
950193845 3:10995293-10995315 TCACATAGCCAGGAGGAGGAAGG + Intronic
950214098 3:11145744-11145766 GTACCTCTGGAGGAGAAGGAGGG - Intronic
950844624 3:16002622-16002644 TCACATCTTCATGAGGAGAATGG + Intergenic
951523990 3:23635837-23635859 GCACTTTTGGAGGCGGAGGAGGG - Intergenic
951619953 3:24590145-24590167 GCTCAGCTTCAGGAGGAGGGGGG + Intergenic
952706169 3:36380321-36380343 GCTCGCCCGCAGGAGGAGGAAGG - Intergenic
953794729 3:45975874-45975896 AAACATGTGCAGAAGGAGGAAGG + Intronic
953896553 3:46807630-46807652 CCACACCTGGAGGTGGAGGATGG + Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954263992 3:49459467-49459489 GAACAGCTGCAGGAAGAGGGAGG + Intergenic
954436615 3:50499643-50499665 GCACACAGGCAGGAGGAGAAGGG + Intronic
955456384 3:59126435-59126457 GCACTTCGGGAGGAGGAGGTGGG - Intergenic
955467146 3:59249125-59249147 GCATATCTGCTGGGTGAGGAGGG + Intergenic
955619848 3:60851040-60851062 GATCATCTCCAGGAGGAGGGAGG + Intronic
956008822 3:64808600-64808622 CCACATCTGTAGGAGATGGAAGG + Intergenic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
958472290 3:94535950-94535972 GCACCCCTGCAGGTGGAAGAGGG - Intergenic
959619078 3:108380637-108380659 GCAAAGCTGAAGGAGGAGGCTGG + Exonic
960396466 3:117143633-117143655 GCAGATATGAAGGAGTAGGAAGG - Intergenic
960444509 3:117731210-117731232 GCAAATGTGGAGGTGGAGGAGGG + Intergenic
960937246 3:122911712-122911734 GCCCATCCACAGGATGAGGAGGG + Intronic
961110277 3:124277669-124277691 GCACGCCTGCAGGAGGAGTGTGG + Intronic
961257021 3:125564202-125564224 GCACAGCTACAGGAGGAGTCTGG + Intronic
961434823 3:126909652-126909674 GGGCAGCTGGAGGAGGAGGAGGG + Intronic
961681841 3:128604602-128604624 GCAGGACTGCAGGAGGAGGCTGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962269402 3:133967048-133967070 GCCCACCTGTAGCAGGAGGATGG - Intronic
963745830 3:149124487-149124509 GCACTCATGCAGGACGAGGAGGG - Intergenic
963936812 3:151062065-151062087 GCACTTCGGCAGGCGGAGGCGGG + Intergenic
964159253 3:153626805-153626827 GCACATTTGTAGAAGGGGGATGG + Intergenic
964204881 3:154162630-154162652 GCACATCTTTGGGAGGTGGAAGG - Intronic
966849570 3:184156134-184156156 GCTCCTCGGCAGGAGGAGGATGG - Intronic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
967984063 3:195082414-195082436 GCAGCTGTGCAGGAGCAGGAAGG + Intronic
968595228 4:1478919-1478941 GAGCATCTGCAGGAGCGGGAAGG + Intergenic
968596967 4:1490741-1490763 GCTCATCCGCAGGAGGAGCCGGG + Intergenic
968711835 4:2125187-2125209 GCACAGCTGTAGGAGGAGCCAGG + Intronic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968986949 4:3880663-3880685 GCAGATCTGCAGGAGGAACCCGG - Intergenic
969556720 4:7916599-7916621 CCACTCCTGCAGGAGGGGGAGGG - Intronic
969613389 4:8238979-8239001 GCACCTCTACACAAGGAGGAGGG - Intronic
969855557 4:9996461-9996483 GCACCTCTGCAGCAGGATGGAGG + Intronic
969891636 4:10265192-10265214 ACACATCTGCAGAAAGAGCAAGG - Intergenic
970542833 4:17096433-17096455 GAGCATCTGCTGGAGAAGGAAGG - Intergenic
970543645 4:17105033-17105055 GCACAGTGGCAGGAGGAGAAGGG - Intergenic
971328783 4:25665412-25665434 GCACTTCGGGAGGCGGAGGACGG - Intronic
971447767 4:26769792-26769814 GCACTTCTGGAGGCTGAGGAGGG - Intergenic
972674858 4:41250416-41250438 GAACTTCTGCTGGAGGGGGATGG - Intergenic
973982164 4:56315779-56315801 GAACACCAGCAGGAGGAGGCTGG - Exonic
975486987 4:74944627-74944649 GCACATCAGCAAGAGTAGGCAGG + Intronic
976217555 4:82729327-82729349 GGACTTCTGGAGGAGGAGGGAGG + Intronic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
980426927 4:132637359-132637381 GCACATCTTCAGAAGGTGGCAGG - Intergenic
980900508 4:138900745-138900767 GCACATCGGGAGGCGGAGGTGGG + Intergenic
981205506 4:142035126-142035148 TCACATCAGCACGAGGAGGCAGG + Intronic
982689604 4:158532851-158532873 GCACATCTCTAGGAGAAGCAGGG - Intronic
984494285 4:180475207-180475229 GCACATCTTTGGGAGGTGGAAGG - Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985507868 5:294792-294814 GTCCATCGGCAGGAGGAGGCGGG + Intronic
985630660 5:1012374-1012396 CCACATCTGCAGGAGGCAGCAGG + Intronic
985712561 5:1437722-1437744 GCAGGTCTGCAGGAGGGGAAGGG + Intronic
985740168 5:1610879-1610901 GTCCATCGGCAGGAGGAGGCGGG - Intergenic
986392254 5:7297816-7297838 GCACAGCTGAAGCATGAGGAAGG + Intergenic
988665401 5:33321860-33321882 CCACTTCTGCATGATGAGGAAGG + Intergenic
989669075 5:43892632-43892654 GCACATCTTTAGGATGTGGAAGG + Intergenic
991516170 5:67438006-67438028 GTACATCTGCAGAAGTAGGCTGG + Intergenic
991902683 5:71476403-71476425 GCACTTCTGCTGGAGGAGTTGGG + Intronic
992558899 5:77930554-77930576 GCCCTTCTGCAGGAGGAAGGTGG - Intergenic
994518014 5:100794563-100794585 GGACACCTGCAGGATGAGCAAGG - Intergenic
997078212 5:130706291-130706313 GCACATCTGCAATAGGATGAAGG + Intergenic
997478172 5:134161076-134161098 CATCATCTTCAGGAGGAGGAGGG + Exonic
1000307737 5:160010679-160010701 GCCCATCTCCAGGAGGACCAGGG + Exonic
1001848010 5:174938584-174938606 GCACAGCTGCACATGGAGGAAGG - Intergenic
1001880814 5:175242615-175242637 GCCTATTTGCAGGAGGAGGTGGG + Intergenic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002705691 5:181159940-181159962 GAACACCTGCAGGCAGAGGATGG + Intergenic
1003064881 6:2895333-2895355 GAAGAGCCGCAGGAGGAGGACGG + Intronic
1003409997 6:5853703-5853725 GCACATTGGCAGGAGGAATAAGG + Intergenic
1003704804 6:8513293-8513315 GAACACCTGCAGAAGGAGCATGG - Intergenic
1003777342 6:9383163-9383185 GCAAAACTGCAAGAGGAGAATGG + Intergenic
1004300090 6:14449755-14449777 GCACATTTTGAGGAGGAGGGAGG + Intergenic
1004650202 6:17600662-17600684 GCAGAGCTGCAGGAGCAGGCGGG + Exonic
1005391933 6:25342862-25342884 GTGCAGCTGGAGGAGGAGGAAGG - Intronic
1005979988 6:30829341-30829363 GGGCACCTGCAAGAGGAGGAAGG + Intergenic
1006084729 6:31587749-31587771 GCACTGCTGCAGGGGGAGGGAGG - Intronic
1006160679 6:32039077-32039099 GCTTGTCTGCAGGAGGAGGTGGG - Exonic
1006391973 6:33763887-33763909 CCAGCTCTACAGGAGGAGGAAGG - Intergenic
1006793340 6:36717496-36717518 GCCCAGCTGCAGGAGGAGCTGGG - Intronic
1007837009 6:44681787-44681809 GCACTACTGCAGGCGGAGGAAGG - Intergenic
1007847945 6:44776304-44776326 GCAGATATGCATGAGGTGGAAGG - Intergenic
1008583796 6:52930561-52930583 GCACATATTCAGGAGGAGGGAGG + Intergenic
1008674940 6:53809388-53809410 GCAAAATGGCAGGAGGAGGAAGG + Intronic
1009398726 6:63230204-63230226 GCACAGGTGCAGGAGCAGCAGGG + Intergenic
1010317082 6:74464259-74464281 CCACCACTGCAGGAGGATGAGGG + Intergenic
1012783782 6:103597134-103597156 GAACATTTAAAGGAGGAGGAAGG + Intergenic
1013607688 6:111765424-111765446 GGCCATCTGCAAGACGAGGAGGG + Intronic
1014942637 6:127461069-127461091 GCACTTCTGGAGGCGGAGGCAGG + Intronic
1017324863 6:153132183-153132205 CCACATCTGTGGGAAGAGGAGGG + Intergenic
1017382323 6:153844940-153844962 TCAGATCAGCAGGAGGAGGCAGG - Intergenic
1018044305 6:159952365-159952387 GCACTGGTACAGGAGGAGGATGG - Intergenic
1018355546 6:163011169-163011191 GCATGACTGCAGCAGGAGGAAGG - Intronic
1018368797 6:163149212-163149234 GAAGCTCTGCAGGAGAAGGAGGG - Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018808736 6:167281809-167281831 CCACATCTGCAGGTGGAGCTTGG + Intronic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1019079903 6:169423387-169423409 GCACAGCTGCAGTTAGAGGAAGG + Intergenic
1020215231 7:6185256-6185278 GCACATCTGCACCCAGAGGAGGG - Intronic
1022649721 7:32263320-32263342 GTATATATGCAGGGGGAGGAGGG - Intronic
1024774872 7:52772209-52772231 ACACTTCTGCAGGTGGATGAAGG - Intergenic
1027186935 7:75977992-75978014 CAACAGCTGCTGGAGGAGGAGGG + Intronic
1028071018 7:86450922-86450944 TCACATTTCCAGGAGGAAGAAGG + Intergenic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1032713253 7:134481418-134481440 GCACATTTGGAGGCTGAGGAAGG + Intergenic
1034254417 7:149716444-149716466 ACTCATCTTCGGGAGGAGGAAGG - Intronic
1034536294 7:151727926-151727948 GCATGACTGCAGGAGGAGGAAGG - Intronic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1035309498 7:157956273-157956295 GCACATCTGGAGGGGGAGGCTGG + Intronic
1036077857 8:5521270-5521292 CCACATCTGCAGGTGTAGGCCGG + Intergenic
1036727008 8:11229509-11229531 GCAAGTCTGCAGGGGGAGGAAGG - Intergenic
1036962913 8:13265619-13265641 GGACATTTGCAGGAAGATGATGG - Intronic
1037878518 8:22561318-22561340 GCAAGTCTGCAGGAGCAGAAGGG - Exonic
1038394621 8:27237699-27237721 GCCCATCTGCAGGAGGATCTTGG + Intronic
1038781079 8:30568949-30568971 GAACATAGGCAGGAGGAGGGCGG - Intronic
1039379768 8:37074328-37074350 GCACAGCTCCAGGAAGAGCAGGG - Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1039557688 8:38488416-38488438 TGACCTCTGTAGGAGGAGGAAGG + Intergenic
1042886753 8:73560700-73560722 GCACACCTCCAAGAGGAAGAAGG + Intronic
1043323622 8:79022269-79022291 GCACATTTGCAGGAGGAATATGG - Intergenic
1043396560 8:79843050-79843072 ACACACCTGCAGGAGGTGGCTGG - Intergenic
1044230410 8:89769830-89769852 GCAAATCTGCACCAGAAGGAGGG + Exonic
1044805616 8:96005537-96005559 ACACACCTGCAGGAGGATGAAGG + Intergenic
1046743025 8:117848397-117848419 GGCCAGCTGGAGGAGGAGGAGGG - Intronic
1048000733 8:130377617-130377639 GCAGGTCAGCAGGAGAAGGAGGG - Intronic
1048006328 8:130422217-130422239 CAACAGCTGCAGGTGGAGGAAGG + Intronic
1048571791 8:135662946-135662968 GCAGAACTGCAGGAGGTGAAGGG - Intergenic
1049273152 8:141706835-141706857 GCACAGCTGAGTGAGGAGGAAGG + Intergenic
1052388476 9:27850264-27850286 GGACATGTACATGAGGAGGAGGG - Intergenic
1055397621 9:75891448-75891470 GCACATCTGGAAGAGGGGGAGGG - Intronic
1055416645 9:76091242-76091264 GCCCATCTGCAAGCAGAGGAGGG - Intronic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1056560118 9:87722811-87722833 GCCCCTCTGCAGGAGGAAGCTGG + Intergenic
1056758038 9:89394619-89394641 GCACCTCTGCTGCAGGAGGCTGG + Intronic
1058410933 9:104730896-104730918 GCACTTCGGGAGGACGAGGAGGG + Intergenic
1058417123 9:104800915-104800937 GCACATCTGCAGGCAGAGCGTGG - Intronic
1058717968 9:107739297-107739319 AAACATTTGAAGGAGGAGGAAGG - Intergenic
1059319988 9:113462004-113462026 GCAGACCTGCAGGAGCAAGATGG - Exonic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060107479 9:120882297-120882319 GCACAGCAGAAGGAAGAGGATGG - Intronic
1061591802 9:131602765-131602787 GCAAGTCTGCCGGAGGAAGAGGG - Intronic
1061865641 9:133490692-133490714 TCAAGGCTGCAGGAGGAGGATGG + Intergenic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062583456 9:137238227-137238249 CGACAGCTGCAGGAGGAGGAGGG + Intergenic
1062708258 9:137957155-137957177 GCATAGCTGCAGCAGCAGGAAGG + Intronic
1186188799 X:7048750-7048772 TCACCACTGCAGGAGCAGGACGG + Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187827851 X:23350557-23350579 GCAAATCTTCAGGAGGCAGATGG + Intronic
1188482415 X:30649216-30649238 GCACTTCTGGAGGCTGAGGAGGG + Intergenic
1189284626 X:39842598-39842620 GCAGCTCTTCAGGAGGAGAAAGG + Intergenic
1189342467 X:40214871-40214893 GCACATCTGCAGGAGTCTGTTGG - Intergenic
1190413053 X:50156120-50156142 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1190631030 X:52386362-52386384 GCACTTTTGGAGGATGAGGAGGG - Intergenic
1190798641 X:53768766-53768788 TCACATCTGAAGGCGGAGGTGGG - Intergenic
1191877033 X:65807613-65807635 ACACACCTGTAGGAGGTGGATGG - Intergenic
1193061757 X:77214707-77214729 ACACATCTGTAGGAGGTGGCTGG + Intergenic
1193312059 X:80021909-80021931 GCACATGTGCACTGGGAGGAAGG + Intronic
1195437868 X:104865872-104865894 GGCCATCTGCAAGAGGAGCAAGG - Intronic
1195856691 X:109339310-109339332 ACACACCAGCAGGAGGAGGCTGG + Intergenic
1197288180 X:124621226-124621248 GCACTTGTGCAGGAGGCGGGCGG + Intronic
1198130790 X:133693016-133693038 TCACATCTGCCAGAAGAGGAAGG + Intronic
1198946720 X:142024330-142024352 TCACATGTGCAGGAGAAAGACGG - Intergenic
1200184561 X:154173878-154173900 GCAGGTCTACAGGAGGAGAAAGG - Intergenic
1200190212 X:154211016-154211038 GCAGGTCTACAGGAGGAGAAAGG - Intergenic
1200195965 X:154248818-154248840 GCAGGTCTACAGGAGGAGAAAGG - Intergenic
1200201620 X:154285936-154285958 GCAGGTCTACAGGAGGAGAAAGG - Intronic
1200762839 Y:7055720-7055742 GCACATATGAAGGAGGAGCAGGG + Intronic
1202108177 Y:21392029-21392051 GCACTTTGGCAGGATGAGGAAGG + Intergenic
1202133869 Y:21639941-21639963 GCACTTCTGGAGGATGAAGAGGG + Intergenic