ID: 1136549345

View in Genome Browser
Species Human (GRCh38)
Location 16:30974324-30974346
Sequence TGGATATGAGGTCGGTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136549339_1136549345 10 Left 1136549339 16:30974291-30974313 CCATGGATCTGGGGTCTGGAAAG 0: 1
1: 0
2: 4
3: 27
4: 238
Right 1136549345 16:30974324-30974346 TGGATATGAGGTCGGTGCTTAGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136549345 Original CRISPR TGGATATGAGGTCGGTGCTT AGG Intronic
904012682 1:27398741-27398763 TGGATCTGGGGTCTCTGCTTTGG + Intergenic
905485199 1:38291221-38291243 TGGTTCTGATGTCAGTGCTTTGG - Intergenic
919145307 1:193626677-193626699 TGGATTTGAGCTCGGTAGTTTGG + Intergenic
919895611 1:202008095-202008117 TGGATTTGAGGTCAGTGCCTTGG - Exonic
920735673 1:208531147-208531169 TGAATAGGAGGTGGCTGCTTGGG + Intergenic
920892978 1:210011446-210011468 TGGATATCAGGCTGGTGCTGAGG - Intronic
922668470 1:227491896-227491918 TGGATGTGAGCTGGGTGCTCGGG - Intergenic
1068050208 10:51940786-51940808 TGGTTATGGGCTTGGTGCTTTGG - Intronic
1069040395 10:63690017-63690039 GGGATATGAGGCTGGTGTTTTGG - Intergenic
1069903558 10:71719614-71719636 TGGCTCTGAGGTCAGTGCTTGGG - Exonic
1070313084 10:75287775-75287797 TGGATATGAGGTCATAGCTTTGG - Intergenic
1077873369 11:6281988-6282010 TAGAAATGAGGTGGGTGATTGGG + Intergenic
1078509951 11:11977618-11977640 TGGATAGGTGGTCGGGGCTGTGG - Intronic
1079383460 11:19958817-19958839 TTATTATGAGGTTGGTGCTTGGG + Intronic
1080226933 11:29972482-29972504 TGGAGATGAGGGTGGTGCCTAGG - Intergenic
1094080150 12:26525909-26525931 TGGATTGGAGGTTGGGGCTTAGG - Intronic
1099345983 12:81500254-81500276 TGGTTATGAGGTCAGAGTTTGGG - Intronic
1100335772 12:93627752-93627774 TGGATATGAGGTTACTTCTTGGG - Intergenic
1103325089 12:120115213-120115235 TGGAGATGTGGTTGGTGGTTTGG - Intronic
1118559110 14:67058742-67058764 TGGAGATGACTCCGGTGCTTGGG + Exonic
1119401211 14:74363941-74363963 GGGATATGAGGTGGCTGCTCAGG - Intergenic
1120968764 14:90190538-90190560 GGCATTTGAGGTCAGTGCTTAGG + Intergenic
1124419835 15:29511281-29511303 TGGATATAAGGAGGCTGCTTTGG - Intronic
1128681271 15:69653640-69653662 TGGATCTGAGGTCAGTGAATAGG + Intergenic
1135917945 16:26622965-26622987 TGGAAATGGGGTTGGGGCTTGGG - Intergenic
1136549345 16:30974324-30974346 TGGATATGAGGTCGGTGCTTAGG + Intronic
1137658446 16:50181821-50181843 TGGAGATGAGGTGGGTACTCAGG + Intronic
1142804473 17:2364174-2364196 TGGAAAAGAGGTGGGGGCTTTGG + Exonic
1142877387 17:2860087-2860109 TGGACATGAGGACTGTGCCTGGG + Intronic
1142902440 17:3020420-3020442 GGGATAGGAGATCGGTGTTTGGG + Intronic
1144037671 17:11382006-11382028 TGGGTTTGAGGTTGGTGGTTGGG + Intronic
1145062249 17:19740481-19740503 TGGAGAAGAGGTGGGGGCTTCGG + Intronic
1147196389 17:38769636-38769658 TGGATATGGGGTCGGGGATCGGG - Exonic
1154362208 18:13673236-13673258 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362226 18:13673368-13673390 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362232 18:13673411-13673433 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362277 18:13673764-13673786 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362307 18:13673990-13674012 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362391 18:13674662-13674684 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362407 18:13674794-13674816 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362480 18:13675382-13675404 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362492 18:13675471-13675493 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362505 18:13675560-13675582 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362523 18:13675695-13675717 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1154362581 18:13676159-13676181 TGGAAATGAAGTCGGGGCTCAGG - Intronic
1155573861 18:27224086-27224108 TGGAAATAAACTCGGTGCTTCGG - Intergenic
1158802246 18:60926057-60926079 TGCAAAAGAGGCCGGTGCTTGGG + Intergenic
1167503644 19:49860551-49860573 GGGATGTGGGGTCAGTGCTTGGG + Exonic
928699916 2:33888093-33888115 GGGATATGACATCAGTGCTTAGG + Intergenic
937200691 2:120202676-120202698 TGGCTAGGAGGTAGGAGCTTGGG + Intergenic
944323502 2:198376581-198376603 TGGATTTGATGTCGGTGTATTGG - Intronic
944612562 2:201426495-201426517 TGGAGATGAGGAGGGTGGTTTGG - Intronic
1169496698 20:6122761-6122783 TGGAAAGGAGGTGGGTGCTCCGG - Exonic
1169601918 20:7271123-7271145 TGGAGATGCTGTAGGTGCTTTGG + Intergenic
1173403454 20:42744913-42744935 TGGGAATGAGGTCCGTGGTTAGG + Intronic
1178401454 21:32289011-32289033 TGGATATGAAATCTTTGCTTAGG - Intergenic
1182731513 22:32499053-32499075 TGGACTTGGGGTGGGTGCTTTGG + Intergenic
1182879702 22:33722889-33722911 GGGAGTTGAGGTCGGAGCTTGGG + Intronic
1183271609 22:36865786-36865808 TGGAGATGGGGTTGGAGCTTGGG - Intronic
1184970131 22:48013727-48013749 TTGATTTGAGGTAGGTCCTTTGG + Intergenic
961500363 3:127328265-127328287 TGGACATGCTGTAGGTGCTTGGG - Intergenic
962967153 3:140365751-140365773 TGTATTTGGGGTTGGTGCTTTGG + Intronic
972920437 4:43933832-43933854 TGGATATGACTTCAGTGCTAAGG - Intergenic
989736507 5:44714177-44714199 TGGATTTGAGGTTTCTGCTTAGG - Intergenic
990978682 5:61581992-61582014 TGGATATGTGGTAGGTGGGTGGG - Intergenic
1001105722 5:168852452-168852474 TGGATAGGAGGTCAGTGCCCAGG + Intronic
1002315984 5:178343583-178343605 TGGATGTGGGGTCCGTGCATGGG + Intronic
1006538030 6:34715956-34715978 TGGAAATGAGGGAGGGGCTTTGG - Intergenic
1008219605 6:48839414-48839436 TAGATATGAGCTCCGTGCTTCGG + Intergenic
1010184950 6:73133514-73133536 CGGCTGTGATGTCGGTGCTTGGG - Exonic
1013929575 6:115514863-115514885 TGGCTTTGAAGTCTGTGCTTGGG - Intergenic
1019501367 7:1366476-1366498 TGGACATGAGGTCTGAGGTTGGG - Intergenic
1021856213 7:24859142-24859164 TGGATATGAGGTGGGTTATAAGG - Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1027812102 7:82916274-82916296 AGTGTATGAGGTGGGTGCTTGGG + Exonic
1028879770 7:95867079-95867101 TGGATAGGATGTGGCTGCTTGGG - Intronic
1031786461 7:126040459-126040481 TGGATCGGAGGACGCTGCTTGGG - Intergenic
1032494496 7:132350694-132350716 TGGAAGTGAGGTGGCTGCTTTGG + Intronic
1040507597 8:48064739-48064761 TGGATATGAGGAGGTTGCTATGG + Intergenic
1044181321 8:89198884-89198906 TGGACAGGAGGCAGGTGCTTGGG - Intergenic
1045621970 8:103988857-103988879 TGGACATGAGTTCGGAGCTTAGG - Intronic
1049392653 8:142380150-142380172 TGGGAATGAGTTCAGTGCTTAGG - Intronic
1056326071 9:85479972-85479994 TGGCTATGAGTTTGGAGCTTAGG - Intergenic
1057123779 9:92600499-92600521 TGGAGATGAGGTAAGTGCTGAGG + Intronic
1058280002 9:103102914-103102936 TGAATATAAGGCTGGTGCTTTGG + Intergenic
1194307456 X:92266047-92266069 TGGAGATTAGGTCTGTGCTCTGG + Intronic