ID: 1136551755

View in Genome Browser
Species Human (GRCh38)
Location 16:30985759-30985781
Sequence GACCCGCAGCTCCCCGAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136551755_1136551761 5 Left 1136551755 16:30985759-30985781 CCCGGCTCGGGGAGCTGCGGGTC 0: 1
1: 0
2: 3
3: 23
4: 197
Right 1136551761 16:30985787-30985809 CCAACACCTGGGTCCCTGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 261
1136551755_1136551758 -6 Left 1136551755 16:30985759-30985781 CCCGGCTCGGGGAGCTGCGGGTC 0: 1
1: 0
2: 3
3: 23
4: 197
Right 1136551758 16:30985776-30985798 CGGGTCTTTGACCAACACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1136551755_1136551757 -7 Left 1136551755 16:30985759-30985781 CCCGGCTCGGGGAGCTGCGGGTC 0: 1
1: 0
2: 3
3: 23
4: 197
Right 1136551757 16:30985775-30985797 GCGGGTCTTTGACCAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1136551755_1136551766 21 Left 1136551755 16:30985759-30985781 CCCGGCTCGGGGAGCTGCGGGTC 0: 1
1: 0
2: 3
3: 23
4: 197
Right 1136551766 16:30985803-30985825 TGGCTGGAGGAGCTGAAGACAGG 0: 1
1: 1
2: 5
3: 42
4: 398
1136551755_1136551762 8 Left 1136551755 16:30985759-30985781 CCCGGCTCGGGGAGCTGCGGGTC 0: 1
1: 0
2: 3
3: 23
4: 197
Right 1136551762 16:30985790-30985812 ACACCTGGGTCCCTGGCTGGAGG 0: 1
1: 0
2: 8
3: 36
4: 290
1136551755_1136551759 1 Left 1136551755 16:30985759-30985781 CCCGGCTCGGGGAGCTGCGGGTC 0: 1
1: 0
2: 3
3: 23
4: 197
Right 1136551759 16:30985783-30985805 TTGACCAACACCTGGGTCCCTGG 0: 1
1: 0
2: 2
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136551755 Original CRISPR GACCCGCAGCTCCCCGAGCC GGG (reversed) Exonic
900109603 1:999979-1000001 GCCCCGCGCCTCCCCGTGCCGGG + Exonic
900226028 1:1534084-1534106 GATCCACAGCTCACGGAGCCTGG + Exonic
900435695 1:2629554-2629576 GGCGTGGAGCTCCCCGAGCCCGG + Intronic
900474403 1:2869467-2869489 GGTCCCCAGCTCCCAGAGCCTGG + Intergenic
900799823 1:4730390-4730412 AATCCGCAGCTCACCCAGCCTGG + Intronic
901422731 1:9162057-9162079 GTCCTGCAGCTTCCCCAGCCTGG + Intergenic
903072121 1:20731783-20731805 TCCCCGCAGCGCCCCGAGCGAGG - Intronic
903142185 1:21345401-21345423 TTCGCGCAGCTCCCCGCGCCCGG + Intronic
903555002 1:24187074-24187096 GGTCCGCAGCCACCCGAGCCGGG - Intronic
904287519 1:29461775-29461797 GAAGAGCAGCTCCCCAAGCCAGG - Intergenic
904370779 1:30046141-30046163 GAAGAGCAGCTCCCCAAGCCAGG - Intergenic
905235239 1:36542015-36542037 GACCTGCACCTCTCCCAGCCAGG - Intergenic
906646075 1:47476125-47476147 GACCCTCAGCTTCTCGAGTCAGG + Intergenic
909585230 1:77281908-77281930 GCTCCGCGCCTCCCCGAGCCGGG - Intergenic
910145672 1:84077895-84077917 GACCCCCAGCTGGCAGAGCCTGG - Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
916716993 1:167455001-167455023 CTCCCGGAGCTCCCCGAGCCGGG + Intronic
919657713 1:200213910-200213932 GTCCCGGAGCTCCCAGAGGCGGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1067346283 10:45441260-45441282 GACCCGCAGCTCCCCCACCCAGG - Intronic
1070305112 10:75235079-75235101 GACGCGCAGCCCCCGGAGCTGGG - Exonic
1073266726 10:102231986-102232008 CACCCCCAGCTCCCAGAGCACGG - Exonic
1073425356 10:103452488-103452510 GACCCGCTGCTCGCCGTCCCTGG + Intergenic
1075072246 10:119327064-119327086 GACTCTCAGCTCCCAAAGCCTGG - Intronic
1076373125 10:129967528-129967550 GGCACGCCGCTCCCAGAGCCGGG - Intergenic
1077333707 11:1994290-1994312 GGCCGGCAGCTCCCTCAGCCAGG - Intergenic
1077501920 11:2913184-2913206 GGCCCGCCGCCCCCCCAGCCAGG + Intronic
1077575312 11:3378790-3378812 GACCCTCGTCTCCCCGAGTCAGG - Intronic
1078091828 11:8268698-8268720 GAGCAGCAGCTGCCCGGGCCGGG + Intronic
1078877029 11:15409253-15409275 GCCCGGCTGCTCCCCAAGCCTGG + Intergenic
1082809160 11:57468145-57468167 GCCCCTCTGCTCCCCGACCCTGG + Intronic
1083544690 11:63539438-63539460 GAGCTGCAGCTCCCCCAGCCAGG + Intronic
1083638105 11:64131117-64131139 GACCCGCAGCTCCCTGCACAGGG - Intronic
1088797088 11:113273462-113273484 GACCCGGAGCCCACCCAGCCCGG + Intronic
1089448474 11:118572674-118572696 GCCACACTGCTCCCCGAGCCCGG - Intronic
1089621473 11:119725153-119725175 GACCCTCTGCCCCCCAAGCCTGG + Intronic
1090422773 11:126587032-126587054 GACTCCCAGCTCCCTGAGGCAGG - Intronic
1202816687 11_KI270721v1_random:49472-49494 GGCCGGCAGCTCCCTCAGCCAGG - Intergenic
1092121118 12:6044577-6044599 GACCAGCAGCTGCCTGAGCCAGG + Intronic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1097277534 12:57823608-57823630 GGCCCGCAGCTGCCCAAGGCTGG + Exonic
1100327596 12:93553942-93553964 GACTCACAGCTCCACGTGCCTGG + Intergenic
1100391563 12:94149321-94149343 GAGCAGCAGCCCCCCGAGGCCGG - Exonic
1100975964 12:100122903-100122925 GACATGCAGCTCCCTGTGCCTGG + Intronic
1102644633 12:114396182-114396204 GCCCCGCGGCTGCCCGACCCCGG + Intronic
1102945827 12:116987156-116987178 GACCCGCAGCTTGCGGAGCTGGG + Intronic
1105017687 12:132796044-132796066 GCCCTGCAGCTCCCCCAGCCTGG + Exonic
1106253440 13:28001421-28001443 GACCTCGAGCTCCCCAAGCCAGG - Intergenic
1109985564 13:69978966-69978988 GACCCCCAGCCCCCCAAACCAGG - Intronic
1114175732 14:20317942-20317964 GGCCCGCAACTCCCTCAGCCTGG - Exonic
1115429628 14:33301093-33301115 GAGCAGCAGCTCCCAGATCCAGG + Intronic
1116414610 14:44665532-44665554 GACTCACAGCTCCGCGAGGCTGG + Intergenic
1119199537 14:72742441-72742463 GACCCGCGGAGCCTCGAGCCAGG - Intronic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1122206378 14:100149960-100149982 GCCCTGCTGCTCCCCGAGCCAGG + Intronic
1122878875 14:104681078-104681100 CACCAGCTCCTCCCCGAGCCAGG + Intergenic
1122960527 14:105091926-105091948 GAACCCCAGCTCCCAGGGCCTGG + Intergenic
1123054071 14:105561012-105561034 GCCCCGCCGCTTCCCGAGCCCGG - Intergenic
1123078656 14:105681429-105681451 GCCCCGCCGCTTCCCGAGCCCGG - Intergenic
1127855835 15:62953127-62953149 GAGCCGCAGCTGCCGCAGCCCGG + Intergenic
1129344262 15:74906704-74906726 GCCCCGCAGCTCCCGGCGCGCGG + Exonic
1131832035 15:96360399-96360421 GACCCGCCGCTAGCCTAGCCAGG - Intergenic
1132580447 16:682387-682409 GACCCGGAGCCCCCTGACCCAGG + Exonic
1132744763 16:1432036-1432058 GACCCACAGCAGCCCCAGCCCGG + Intergenic
1132844659 16:1994390-1994412 GACCTGGAGCCCCCAGAGCCTGG - Intergenic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1134644695 16:15857059-15857081 GACCCGGAGCTGCCCGCGGCTGG + Intergenic
1135056996 16:19240077-19240099 GCCCAGGAGCTCCCCAAGCCAGG - Intronic
1135323798 16:21513341-21513363 CACCCACAGCCCCCCGACCCTGG + Intergenic
1136335281 16:29606606-29606628 CACCCACAGCCCCCCGACCCTGG + Intergenic
1136551755 16:30985759-30985781 GACCCGCAGCTCCCCGAGCCGGG - Exonic
1137267935 16:46884215-46884237 GTCCCACAGCGCCCCGCGCCGGG - Intergenic
1138519704 16:57563921-57563943 GAGCCGCAGCTCCCTGGGGCGGG - Exonic
1140416141 16:74774934-74774956 GGCGCGCAGCTCCCGGCGCCGGG - Intergenic
1142560839 17:807972-807994 GACCCCCAGGTCACCCAGCCAGG + Intronic
1143609897 17:8012191-8012213 GGCCTTCTGCTCCCCGAGCCAGG - Exonic
1145070282 17:19799889-19799911 GCCCTGCAGCTCCACAAGCCCGG - Intronic
1146496422 17:33326642-33326664 AACCAGCAGCTCCCAGAGCTGGG + Intronic
1146797837 17:35795397-35795419 GCGCAGTAGCTCCCCGAGCCGGG - Exonic
1147900278 17:43779039-43779061 GCTCCGCAGCTCCCGGAGCCCGG - Intergenic
1147901719 17:43790772-43790794 GAGCTGCAGCTCCCTGAGCTAGG - Intergenic
1148760358 17:49996772-49996794 GCTCTGCAGCTCCCCGAGCCCGG + Intergenic
1150283151 17:63940905-63940927 GAACAGCAGCTCGCCAAGCCCGG - Exonic
1150407896 17:64918948-64918970 GACCTGCAGCTGTCCGGGCCAGG + Intronic
1150488519 17:65560086-65560108 CGCCAGCAGCGCCCCGAGCCCGG + Intronic
1151207593 17:72519363-72519385 GGCCTGCAGCTCCCCCAGCTCGG + Intergenic
1151802353 17:76385616-76385638 GACCCGCGGCTCCCGCTGCCAGG - Exonic
1152044179 17:77925020-77925042 GACCTCCACCTCCCCGAGTCTGG + Intergenic
1152266631 17:79298708-79298730 GACCCCCAGCTTCCCCAGCTGGG - Intronic
1153575303 18:6513635-6513657 GACCTGGAGCTGCCAGAGCCTGG - Exonic
1153816831 18:8798119-8798141 GACTCCAAGCTCCCCGAGCCTGG - Exonic
1159161263 18:64646203-64646225 GACTAGGGGCTCCCCGAGCCAGG - Intergenic
1160164142 18:76495378-76495400 GCCGCGCAGCCCCCCGAGCCCGG - Intergenic
1160441879 18:78899390-78899412 GGCCCCCATCTCCCTGAGCCTGG + Intergenic
1160745475 19:709184-709206 GGCCCGGAGCTCCGGGAGCCGGG + Intronic
1160865749 19:1255225-1255247 GACCCGCGGCCCCCCGGGCAGGG - Intronic
1161027169 19:2042088-2042110 GACCCGCAGTTACCCGGGCTCGG - Intronic
1161099648 19:2415374-2415396 GACCCGCAGCCCACAAAGCCAGG - Intronic
1161581430 19:5083002-5083024 GTCCCCCAGCTCCCAGTGCCTGG + Intronic
1161767355 19:6214975-6214997 GACCTGGAGCTGCCAGAGCCGGG - Intronic
1162791371 19:13064723-13064745 GACCCTCAGCTCCCCTCCCCAGG - Intronic
1163311022 19:16514704-16514726 GAGCGGCAGCTCCCAGAGGCCGG + Intronic
1163679386 19:18672023-18672045 GCCCGGCACCGCCCCGAGCCTGG + Intergenic
1163762981 19:19147043-19147065 GACCAGCAGCCCCCAAAGCCGGG - Exonic
1163829537 19:19541123-19541145 GGCCCACAGCTCCCCGAGCAGGG - Exonic
1164136505 19:22421856-22421878 CACCCCCAGCACCCCGAGTCAGG + Intronic
1166290565 19:41860615-41860637 GACCCGCAGGAGCCGGAGCCCGG + Intronic
1166670961 19:44709407-44709429 GACCGGGAGCTCCCAGAGTCAGG + Intronic
1166670987 19:44709533-44709555 GACCGGGAGCTCCCAGAGTCAGG + Intronic
1167736202 19:51295947-51295969 AACACTCAGCTCCCCGAGCCGGG - Intergenic
1168233061 19:55045373-55045395 GACCCGGAGCTCCCTGACCGGGG - Intronic
925180691 2:1815253-1815275 GTGACGCAGCTCCCAGAGCCTGG + Intronic
926151378 2:10427413-10427435 GGCCCGCAGCCCCCTGAGCCTGG + Exonic
933902887 2:86861951-86861973 CCCCCCCAGCTCCCCGACCCAGG - Intergenic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
935777658 2:106487319-106487341 CCCCCCCAGCTCCCCGACCCAGG + Intergenic
938290198 2:130144942-130144964 GCCCCCCAGCTCGCCGACCCCGG - Exonic
938305041 2:130247461-130247483 AGCCAGCAGCTCCCTGAGCCAGG - Intergenic
938466331 2:131528003-131528025 GCCCCCCAGCTCGCCGACCCCGG + Exonic
938583522 2:132669094-132669116 GCGCCGCAAGTCCCCGAGCCCGG + Intronic
948332440 2:237180366-237180388 GAAACCCAGCTGCCCGAGCCCGG + Intergenic
948492207 2:238320800-238320822 GACCCGCACCTGGCCGGGCCCGG - Intronic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948894053 2:240920055-240920077 GGCCAGCAGGTCCCCCAGCCGGG - Exonic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1172848423 20:37944182-37944204 GCCCCGCCGCCCCCCAAGCCAGG + Exonic
1173363872 20:42368014-42368036 GGTCCGCAGCACCCAGAGCCTGG - Intronic
1175215597 20:57390402-57390424 GACCCGCAGGTCCGGGATCCCGG + Intergenic
1175883785 20:62276482-62276504 GACCAGCAGCTGACCCAGCCAGG - Intronic
1176005621 20:62861039-62861061 GGCCCCGAGCCCCCCGAGCCGGG - Exonic
1176993043 21:15521638-15521660 GCCTAGAAGCTCCCCGAGCCAGG - Intergenic
1178414442 21:32392768-32392790 GACCCGCAGGGCCCCGGGCCAGG - Exonic
1178493621 21:33070087-33070109 GCCCCGCAGGTTCCCAAGCCGGG + Intergenic
1178915065 21:36701445-36701467 GCCCCGCGGCTCCCCGGCCCAGG + Intronic
1179247144 21:39643814-39643836 TTCCCGCAGCTCCTCGAGGCTGG + Intronic
1179582334 21:42351798-42351820 GACCCGAAGTTCCCCACGCCAGG + Intergenic
1179889086 21:44326826-44326848 GACCCGCCGCACCCTGAGCATGG + Exonic
1182467490 22:30526241-30526263 GACCAGCAACTCCTGGAGCCTGG + Intronic
1182473466 22:30562622-30562644 ATCCCTGAGCTCCCCGAGCCTGG + Intronic
1183326972 22:37199558-37199580 GACCCGCAGCTCCGCTCGGCTGG - Intergenic
1183326984 22:37199613-37199635 GACCCGCGGCGCCCCCTGCCGGG + Intergenic
1184233799 22:43172358-43172380 GTCACCCAGCTCCCCGACCCTGG + Intronic
1184568786 22:45309629-45309651 GACGCGCGGCTCGCCGGGCCAGG + Exonic
1184712785 22:46262961-46262983 GACCTGCAGCTCTCCGCGCGCGG - Exonic
949876397 3:8628710-8628732 GGCCCGCAGCTCCCAGAAGCTGG + Intronic
953903942 3:46858826-46858848 CACCCGCTGCTCCCCAAGTCTGG + Intronic
954714192 3:52518960-52518982 GAACCCCACCTCCCCTAGCCAGG + Intronic
955303872 3:57810039-57810061 GACCTGGAGCTCCCCAAGCCAGG + Intronic
957097757 3:75792577-75792599 GACCTGGAGCTCCCCGAGCCAGG - Intergenic
959398364 3:105869040-105869062 GCCCCGCCCCGCCCCGAGCCTGG - Exonic
960142247 3:114162448-114162470 CACCCCCAGCTCCCAGAGCAGGG + Intronic
961171801 3:124802514-124802536 GCCCCTCAACTCCCCGTGCCAGG + Intronic
963081847 3:141402242-141402264 GACCCGCAGCCCCGCGGGCCCGG - Intronic
968478592 4:824311-824333 GCCCAGCAGCGCCCCCAGCCCGG - Intronic
968520818 4:1033956-1033978 GCCCCGCCCCTCCCCGAGCCTGG - Intergenic
968929244 4:3569796-3569818 GACCCGCAGCTCCGCGTCGCAGG + Intergenic
969113300 4:4856818-4856840 GCCCCTCGGCTTCCCGAGCCGGG - Intergenic
969174552 4:5388587-5388609 GACCCTGAGCTCCCCAAGGCTGG - Intronic
969455808 4:7299053-7299075 GTCCCCCAGCTCCCCCAGCTGGG + Intronic
970407655 4:15778793-15778815 GGCCCGCGGAGCCCCGAGCCCGG - Intronic
979462943 4:121004010-121004032 GACCTGGAGCTCCCTGAGCCAGG + Intergenic
985647508 5:1091932-1091954 GGCCACAAGCTCCCCGAGCCGGG + Intronic
985669924 5:1201939-1201961 GACCCTCGGCTCCCCAAGCACGG + Intronic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986402652 5:7395675-7395697 GCCCCGCAGTGCTCCGAGCCAGG + Intergenic
986871202 5:12048832-12048854 GACCCACAGTTCCCCAAGGCTGG - Intergenic
998136443 5:139676737-139676759 GACCCTCAAGTCCCTGAGCCTGG + Intronic
1001798329 5:174520530-174520552 GACCCCCAGCTCTCCGCGGCGGG + Intergenic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006368230 6:33628463-33628485 GACCCCAAGCTCTCCAAGCCAGG - Intronic
1007631340 6:43275177-43275199 CCCCCGCAGGTCCCCAAGCCAGG + Intronic
1007805827 6:44445179-44445201 ATCCCTCAGCTCCCAGAGCCAGG + Intronic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1011723452 6:90183712-90183734 TACCAGCAGCTCACAGAGCCTGG - Intronic
1012752845 6:103184758-103184780 GACCTAGAGCTCCCTGAGCCAGG + Intergenic
1014098215 6:117482708-117482730 GAGCCGCAGCTGCCCGGGCCGGG - Exonic
1014310336 6:119792156-119792178 GACCCCTAGCACCCAGAGCCAGG + Intergenic
1014844391 6:126258011-126258033 AACCAGCAGCTCCTCGACCCTGG + Intergenic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019409257 7:899513-899535 GACCGGCAGGTCGCCGAGGCAGG + Intronic
1020094599 7:5361499-5361521 GTCCCCCAGCACCCCGAGGCAGG + Intronic
1023418359 7:39951649-39951671 GAGCCGCAAGTCCCCCAGCCCGG + Exonic
1023836668 7:44072687-44072709 GTACTGCAGCGCCCCGAGCCAGG - Exonic
1027041486 7:74964701-74964723 CACCAGCTGCTCCCCGCGCCGGG + Intergenic
1027082156 7:75237668-75237690 CACCAGCTGCTCCCCGCGCCGGG - Intergenic
1030484410 7:110148420-110148442 GCCTAGTAGCTCCCCGAGCCAGG - Intergenic
1032705494 7:134418074-134418096 CACCAGCAGCTCCCCGACCAGGG - Intergenic
1034902621 7:154916651-154916673 GACATGCAGGGCCCCGAGCCGGG - Intergenic
1035755323 8:2026732-2026754 GACCCCCAGCCCCCGGAGCAGGG - Intergenic
1036220115 8:6914417-6914439 TGCCCGCAGCTCCCTGCGCCCGG + Intergenic
1041051574 8:53939657-53939679 GACCCGCGACTCCCCGCTCCGGG - Exonic
1042020575 8:64369409-64369431 GGCCCGCAGCTCCTCGCGGCCGG + Intergenic
1042307018 8:67343318-67343340 GACCCGCGGCTCCCAGCGGCTGG + Exonic
1045916789 8:107481663-107481685 GACCCGCAGTTCCCAGTGTCTGG + Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049799662 8:144511921-144511943 GACGCACAGGGCCCCGAGCCAGG - Exonic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1053803941 9:41783233-41783255 GACCCGCAGCTCCGCGTCGCAGG + Intergenic
1054141339 9:61532224-61532246 GACCCGCAGCTCCGCGTCGCAGG - Intergenic
1054192245 9:61994731-61994753 GACCCGCAGCTCCGCGTCGCAGG + Intergenic
1054646161 9:67593960-67593982 GACCCGCAGCTCCGCGTCGCAGG - Intergenic
1058053438 9:100427671-100427693 CCCGAGCAGCTCCCCGAGCCCGG - Intronic
1058504791 9:105656350-105656372 GACCCGCAGGCCCACGAGCCCGG - Intergenic
1059763359 9:117360534-117360556 GACCAGCAGCTCCACGAGGGTGG - Intronic
1060722044 9:125986028-125986050 CACCGGCAGGTCCCCGAGCCTGG + Intergenic
1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG + Intergenic
1060968505 9:127724707-127724729 GACCCCCAACTCCCAGTGCCCGG - Intronic
1061453399 9:130681140-130681162 GGCCCTCAGCGCCCCCAGCCCGG - Intronic
1061665990 9:132161455-132161477 GACCCGCTGGCCCCCGGGCCGGG + Intergenic
1061856034 9:133442510-133442532 GCCCCACAGCTCACCGAGCAGGG - Exonic
1062529909 9:136995279-136995301 ATCCCGCAGCTTCCCCAGCCTGG - Exonic
1062623759 9:137433955-137433977 GACCCCCGGCTCCCTGAGGCAGG - Exonic
1185761113 X:2690765-2690787 GACCCGCACTTTCCCGAGCAGGG + Intergenic
1190693411 X:52931508-52931530 GACCAGGAGATCCCTGAGCCTGG - Intronic
1192260800 X:69504996-69505018 GCCCCGCACCGCCCCCAGCCGGG + Intergenic
1200251943 X:154558575-154558597 CTCCTGCAGCTCCCCGAGCAAGG - Exonic
1200265824 X:154645841-154645863 CTCCTGCAGCTCCCCGAGCAAGG + Intergenic