ID: 1136552172

View in Genome Browser
Species Human (GRCh38)
Location 16:30987634-30987656
Sequence TCCCCACAGCAGCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 497}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136552172_1136552183 11 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552183 16:30987668-30987690 ACTACCTGGGCCCAAAGAGGGGG 0: 1
1: 0
2: 3
3: 14
4: 172
1136552172_1136552178 -3 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552178 16:30987654-30987676 GGATGTGGGCGGCAACTACCTGG 0: 1
1: 0
2: 1
3: 7
4: 66
1136552172_1136552179 -2 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552179 16:30987655-30987677 GATGTGGGCGGCAACTACCTGGG 0: 1
1: 0
2: 2
3: 5
4: 50
1136552172_1136552184 14 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552184 16:30987671-30987693 ACCTGGGCCCAAAGAGGGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 431
1136552172_1136552181 9 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552181 16:30987666-30987688 CAACTACCTGGGCCCAAAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 148
1136552172_1136552182 10 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552182 16:30987667-30987689 AACTACCTGGGCCCAAAGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 152
1136552172_1136552180 8 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552180 16:30987665-30987687 GCAACTACCTGGGCCCAAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 144
1136552172_1136552186 20 Left 1136552172 16:30987634-30987656 CCTTTCCCAGGCTGCTGTGGGGA 0: 1
1: 0
2: 6
3: 54
4: 497
Right 1136552186 16:30987677-30987699 GCCCAAAGAGGGGGTGGCCCAGG 0: 1
1: 0
2: 3
3: 22
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136552172 Original CRISPR TCCCCACAGCAGCCTGGGAA AGG (reversed) Intronic
900243838 1:1628892-1628914 ACCCCTAGGCAGCCTGGGAAAGG + Intronic
900291885 1:1927178-1927200 CCCCCACAGGAGCCAGAGAAGGG - Intronic
900410177 1:2509047-2509069 TCCCCAAAGCCGCCTGGATAAGG - Exonic
900826082 1:4928070-4928092 CTCCCACAGCAGCCAGGAAAGGG + Intergenic
901067665 1:6502111-6502133 TAGCCGCAGCAGCCTGGGGAAGG + Intronic
901210208 1:7520311-7520333 ACCCCACAGGACCCTGGGAGAGG - Intronic
901527956 1:9835920-9835942 AGCCCGGAGCAGCCTGGGAAAGG + Intergenic
901650137 1:10738418-10738440 TGCCCACAGCAGGCCGGGGAAGG + Intronic
901873618 1:12153201-12153223 TCCCCGCAGGAGCTTGGGCAGGG - Intergenic
902087547 1:13875009-13875031 TCCCTACAGAAGGCGGGGAAGGG - Intergenic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
903493855 1:23751221-23751243 TCACACCAGAAGCCTGGGAAAGG + Exonic
903648233 1:24907363-24907385 TCCCCAAAGCGGTCAGGGAACGG + Exonic
904036723 1:27562846-27562868 TCCCCACAACAGCCTGCGACGGG + Intronic
904384241 1:30131254-30131276 TCCCCACCACAGGCTGGGGAGGG + Intergenic
904567276 1:31435309-31435331 TCCTCACAACAGCCTAGGAGGGG - Intergenic
904770556 1:32878858-32878880 TCCCCACAGCAGCTCTGCAAGGG + Intergenic
905330347 1:37190839-37190861 ACCCCACAGAAGACTGGGATGGG - Intergenic
905423342 1:37863176-37863198 TCCCCACTGCAGGATGGGAGAGG - Intronic
905852224 1:41282843-41282865 CCCCCACTGCAGCCTGGTAGAGG - Intergenic
906872999 1:49504336-49504358 TCTCCACAGCAGTGTGAGAATGG + Intronic
907300484 1:53483766-53483788 GCCTCACAGCAGCCCAGGAAAGG - Intergenic
907325640 1:53637175-53637197 TCCCCCCGGCAGGCTGGCAATGG + Intronic
907412155 1:54290428-54290450 TGACCACAGCAGGCTGGGGATGG + Intronic
909012535 1:70351129-70351151 TCCTCACAGCAGCCCTGCAAAGG - Intronic
911361331 1:96881037-96881059 TCTTCATAGCAGCCTGAGAACGG - Intergenic
911539922 1:99146278-99146300 TCCCCACTGCAGCCAGGTGATGG - Intergenic
911733379 1:101312235-101312257 TTCCTCCAGCAGCCTGGGCAAGG + Intergenic
912501276 1:110123758-110123780 TCCCCACATGAACCTGGGGAGGG - Intergenic
912689248 1:111792015-111792037 TCGACACAGCAGCCTAGAAATGG - Intronic
914914595 1:151811324-151811346 TCGCCAAAGCATCCTGGCAAAGG - Exonic
915342750 1:155185294-155185316 GCTCCACAACACCCTGGGAATGG - Intronic
915364180 1:155304946-155304968 GCCCCACAGCAGAGTGGAAAAGG - Intergenic
915551481 1:156637936-156637958 TCCCCATAGGAGGCTGGGAGAGG + Intergenic
915934562 1:160083118-160083140 CCAACACAGAAGCCTGGGAAAGG - Intronic
916440022 1:164815498-164815520 TCCTCATAGCAGCGTGAGAATGG - Intronic
916848459 1:168678001-168678023 TCCCAACAGTTACCTGGGAAGGG - Intergenic
916851868 1:168712300-168712322 TCCCCACTGCAGCCCGTGCAGGG + Intronic
916950907 1:169779241-169779263 TCCCCAAAGGAGCCTGAGACTGG - Intronic
918131051 1:181630099-181630121 TTACCACAGCAGGATGGGAATGG + Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
922419017 1:225447081-225447103 TCAAAACAGGAGCCTGGGAAGGG - Intergenic
922419815 1:225452009-225452031 CCCCTAAAGCAGCCTGGGAGTGG + Intergenic
922718641 1:227889307-227889329 CCCCCAGAGCTACCTGGGAAGGG - Intergenic
922815702 1:228447263-228447285 TCCCCTCAACAGCGTGCGAAGGG + Intergenic
924036239 1:239941259-239941281 TCCGTACAGCAGCATGAGAATGG + Intergenic
1064647672 10:17476030-17476052 TCCACACAATAGCCTGGCAAAGG - Intergenic
1064992410 10:21267402-21267424 TCAGAACAGCAGCCTGGGCATGG - Intergenic
1066646570 10:37616654-37616676 GCCCCACAGCAGCCTCTAAAAGG - Intergenic
1066658972 10:37721104-37721126 TCCCCACAGGAGCCTGGCTCTGG - Intergenic
1067750131 10:48966257-48966279 TCTCCCAAGCAGCTTGGGAAAGG + Intronic
1068215684 10:53979120-53979142 TCCCCATAGCAGTGTGAGAACGG - Intronic
1068225996 10:54107811-54107833 TTGCCACAGCAGCCTGGCATGGG + Intronic
1068303489 10:55175937-55175959 TCCCCACTGCAGACTGGAGAGGG - Intronic
1069044225 10:63724874-63724896 GCACCACTGAAGCCTGGGAATGG + Intergenic
1069567445 10:69473342-69473364 CTCCCATAGCAGCCTTGGAAAGG - Intronic
1069639264 10:69944293-69944315 TCCTCACAGCAGCCTGGGACAGG + Intronic
1069979390 10:72241791-72241813 TCCCAACAGCAGGCAGGGAGTGG - Intergenic
1070900399 10:80023142-80023164 TCACCATAAGAGCCTGGGAATGG + Intergenic
1070901191 10:80030361-80030383 TCACCATAAGAGCCTGGGAATGG + Intergenic
1070923268 10:80202299-80202321 TCCTCACATCAGCATGGGCAAGG + Intronic
1070993568 10:80754614-80754636 TCTTCATAGCAGCATGGGAATGG + Intergenic
1071304712 10:84288584-84288606 TCCTCAGGGCAGGCTGGGAAGGG - Intergenic
1072487198 10:95866869-95866891 CCCACAGAGCAGGCTGGGAATGG - Exonic
1072738689 10:97896670-97896692 ACCCCCCATCAGCCTGGGATTGG + Intronic
1074777663 10:116778136-116778158 TGGCCACAGCAGCTTGGGAAAGG + Intergenic
1075082232 10:119391679-119391701 CCCCCACAGCAGGGTGGGAGAGG + Intronic
1075234424 10:120713680-120713702 GGCACACAGCTGCCTGGGAAGGG + Intergenic
1076175139 10:128362577-128362599 ACCCCGCAGCAGCTTGGGTATGG - Intergenic
1076292339 10:129355963-129355985 TCCCCACATCTGGCTGGGCATGG - Intergenic
1076450052 10:130551117-130551139 TGCCCTCTGCAGCCTGGAAAGGG - Intergenic
1076517603 10:131056969-131056991 GCCTCGCAGCAGCCTGGTAAGGG - Intergenic
1076700852 10:132271871-132271893 GCCCCAGTGCTGCCTGGGAAGGG - Intronic
1077662541 11:4082612-4082634 TCCCCATGGCAGCCTGGGGCTGG - Intronic
1077744584 11:4887939-4887961 TCCCCACAGCCTCATGGGGAAGG - Intronic
1078103996 11:8346981-8347003 TTCCCACAGATGACTGGGAAGGG + Intergenic
1078686814 11:13539605-13539627 GCTCCACAGGAGCCAGGGAAGGG - Intergenic
1080785915 11:35474938-35474960 TCCACCCAACAGCTTGGGAAGGG + Intronic
1081072237 11:38625813-38625835 TACCCTCATCAGCCTGGGAAAGG - Intergenic
1081275386 11:41141815-41141837 TCTTCATAGCAGCCTGAGAATGG + Intronic
1081485040 11:43521075-43521097 TCTTCACAGCAGCGTGAGAATGG - Intergenic
1081688076 11:45056553-45056575 TCCCCCCTGTACCCTGGGAAAGG - Intergenic
1082795931 11:57377757-57377779 TCCCCAGGGCAACCTGGGAATGG - Exonic
1083542263 11:63520345-63520367 TCACGAGAACAGCCTGGGAAAGG - Intergenic
1083593889 11:63909981-63910003 TCCCCACAGCAGCTTGTGGAAGG - Exonic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1084116453 11:67045479-67045501 TCCCCAGAGCATCCTAGGAGGGG + Intronic
1084477880 11:69399066-69399088 TGCCCACAGCAGGCTGGGCACGG + Intergenic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1085718033 11:78890140-78890162 TCACCACAGAGACCTGGGAAAGG + Intronic
1086797505 11:91125973-91125995 TCCCCACAGCTGCCTTCCAAGGG + Intergenic
1087013517 11:93534889-93534911 TCCCCAGAGCATCCTGCTAAGGG + Intronic
1087175472 11:95091197-95091219 TTCCCCCAGCAGCCTGGGCAGGG - Intronic
1087423247 11:97959408-97959430 TCTTCACAGCAGCATGAGAACGG - Intergenic
1088914013 11:114213132-114213154 TCCCTACAGCAGCCAGGCCATGG - Intronic
1089311505 11:117561071-117561093 TGTCCACAACAGCCTGGGGAGGG - Intronic
1089473866 11:118742800-118742822 TCCACACAGCATAGTGGGAATGG - Intergenic
1089657912 11:119965118-119965140 TCCCCACAGGTGCCTTGGGAAGG + Intergenic
1089708761 11:120299929-120299951 ACCCAACAGGAGGCTGGGAAGGG - Intronic
1089802384 11:121044420-121044442 TTGCCAAAGCAGCCTGGCAATGG - Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090831445 11:130423552-130423574 TCCCCACAGCATGCAGGTAAGGG + Intronic
1090866340 11:130704071-130704093 TCGCCACAGCTGCCTTTGAAAGG - Intronic
1091124679 11:133083442-133083464 ACCCCACCCCAGCCTGGGAAGGG + Intronic
1091187726 11:133661600-133661622 TCCACACAGCCGTCTGGGAATGG - Intergenic
1091642316 12:2246758-2246780 TCCACACCGCTGCCTGGGCATGG + Intronic
1091921451 12:4308126-4308148 TCCCCAGGGCAGCCTGGGGAAGG + Intergenic
1092187673 12:6493245-6493267 CGCCCACAGCTGCCTGGGTAAGG - Exonic
1095617862 12:44213874-44213896 TCTTCACAGCAGCATGAGAATGG + Intronic
1095957220 12:47813689-47813711 CCCCCACAGCAGGATGGGGAGGG - Intronic
1096110864 12:49028301-49028323 TGCCCACAGCAGTTTGGGAAAGG - Intronic
1096544807 12:52330637-52330659 TCTTCACAGCAGCGTGAGAATGG + Intergenic
1096780510 12:53989082-53989104 ACCCCACAGCAGGCTGGCAAAGG + Intronic
1097053813 12:56238627-56238649 AGGCCACAGAAGCCTGGGAAGGG - Exonic
1097055975 12:56249284-56249306 TCCCCAGGGAAGGCTGGGAAAGG - Intronic
1098317517 12:69207852-69207874 TCTTCATAGCAGCATGGGAAGGG + Intergenic
1100536508 12:95515609-95515631 TCCCAACAGTTACCTGGGAAGGG - Exonic
1100979733 12:100154824-100154846 TCCCAATAGCACCCTGGTAATGG - Intergenic
1101591308 12:106127869-106127891 TCCCTGCAGCAGCCTGGGCACGG - Intronic
1103779933 12:123391679-123391701 TCCCCACTGCAGCTTTGAAAGGG - Intronic
1103830572 12:123775822-123775844 TCCCTACAGCAGCATGAAAATGG - Intronic
1104303376 12:127586697-127586719 TCCCCACAGGGGCTTTGGAAGGG - Intergenic
1104344697 12:127984938-127984960 TTCCAACAGCAGCCTGGGGAGGG + Intergenic
1104734929 12:131130842-131130864 TCCCCACGCCAGCCTGGGCGCGG - Intronic
1104993670 12:132641102-132641124 TCCCCACATCAGCCCAGGGACGG - Intronic
1105644677 13:22304105-22304127 TCCCTATAGCAGCATGAGAATGG - Intergenic
1105815614 13:24033608-24033630 TCCCCACTGCAGGCTGGGCAAGG - Intronic
1106564304 13:30871560-30871582 GCCTCCCTGCAGCCTGGGAAGGG - Intergenic
1106594086 13:31122372-31122394 TCCTCACCGCAGCCTAGAAAGGG + Intergenic
1107749238 13:43546464-43546486 ACCCCACAGGAGCCTGGGGATGG + Intronic
1108556716 13:51600680-51600702 TCCCCACTGCAGTCTGTGGATGG + Intronic
1110816627 13:79867431-79867453 TCCCCACAGCAGTGTGCTAAGGG - Intergenic
1113334071 13:109361349-109361371 TTGCAAGAGCAGCCTGGGAAAGG + Intergenic
1113556360 13:111238873-111238895 TCTTCACAGCAGCGTGAGAACGG - Intronic
1113694021 13:112331223-112331245 TCCCCGGTGCAGCCTTGGAAGGG - Intergenic
1113809954 13:113134294-113134316 TCTTCACAGCAGCGTGAGAAGGG - Intronic
1114567963 14:23646248-23646270 TCTCCACACCAGCCGGGGACGGG + Intergenic
1114984114 14:28205702-28205724 TCTCCATAGCAGCATGAGAATGG - Intergenic
1116507506 14:45703281-45703303 TCTTCACAGCAGCGTGAGAACGG - Intergenic
1117327766 14:54684714-54684736 TGCCCACAGCTGTCTGGGGATGG + Intronic
1117632889 14:57711370-57711392 TCTTCACAGCAGCGTGAGAATGG + Intronic
1118721029 14:68593960-68593982 ACCCCTCAGCGGCTTGGGAAAGG + Intronic
1119011542 14:70995801-70995823 TGAGCACTGCAGCCTGGGAAGGG - Exonic
1119018925 14:71089415-71089437 TCCTTACAGCAGCGTGAGAATGG - Intronic
1120084407 14:80253322-80253344 TCTTCATAGCAGCCTGAGAATGG + Intronic
1121427120 14:93860281-93860303 TCCTCACAGCTGCCCTGGAAGGG + Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1121902147 14:97703391-97703413 TCCCCACAGGAGCATGCGCATGG - Intergenic
1122596726 14:102898984-102899006 TCCCCACAGGAGGCTGGGCGTGG + Intronic
1122767745 14:104083448-104083470 TCCTCACAGCTGCCTGGGCTAGG - Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1123019051 14:105389065-105389087 TGCCCACTGCAGCCTGGGCTTGG - Intronic
1202852433 14_GL000225v1_random:30099-30121 TCCCCACGGAAGCCCGGGAACGG + Intergenic
1202859659 14_GL000225v1_random:73175-73197 TCCCCACGGAAGCCCGGGGACGG - Intergenic
1202860826 14_GL000225v1_random:80007-80029 TCCCCGCAGAAGCCCGGGGACGG - Intergenic
1124013268 15:25856450-25856472 TCTTCATAGCAGCCTGAGAATGG + Intronic
1124340941 15:28888815-28888837 TCCTCACAGCCACCTGGCAAGGG - Intronic
1124483640 15:30098176-30098198 TCCCAACAGCACCCTAGAAATGG + Intergenic
1124519939 15:30399050-30399072 TCCCAACAGCACCCTAGAAATGG - Intergenic
1124538716 15:30567172-30567194 TCCCAACAGCACCCTAGAAATGG + Intergenic
1124722332 15:32120973-32120995 ACCCCACAGCAGGCTCGGGAAGG - Intronic
1124759934 15:32440408-32440430 TCCCAACAGCACCCTAGAAATGG - Intergenic
1124840799 15:33240521-33240543 GACCCACTGCATCCTGGGAAAGG + Intergenic
1124973809 15:34515049-34515071 CCCCCACTACCGCCTGGGAAAGG + Intergenic
1125225969 15:37396666-37396688 TCCCCAGAGAACCCTGGGAGTGG + Intergenic
1126157205 15:45576768-45576790 TCCTCACAGGTGCTTGGGAAAGG - Intergenic
1127010938 15:54626819-54626841 TCCACACAGCATTCTCGGAAAGG + Exonic
1127260023 15:57320609-57320631 CCCCCAGAGCAGCCTGGGGAGGG + Intergenic
1127531046 15:59843835-59843857 TCCTCAAGGCAGCTTGGGAATGG - Intergenic
1127695341 15:61441380-61441402 TACCCATAGCAGCCTGGAGAGGG - Intergenic
1127772170 15:62241200-62241222 TCCCAACAGCACCCTAGTAATGG - Intergenic
1127849517 15:62900928-62900950 ACCCCACAGCAGTCTGGGGCTGG + Intergenic
1128248353 15:66148369-66148391 TTGCCAAAGGAGCCTGGGAAGGG - Intronic
1128354066 15:66912132-66912154 TCCTCACAGCAGCCTGTGAGGGG + Intergenic
1128442729 15:67727906-67727928 TCCCAAGAGCAAGCTGGGAAAGG - Exonic
1128474461 15:67985251-67985273 TCCTTACAGCAGCATGAGAACGG - Intergenic
1128565832 15:68699985-68700007 CCCCCGCTGCAGCCTGGGAGGGG + Intronic
1128742665 15:70095108-70095130 TCCTCACAACACCCTGGGGAAGG + Intronic
1128943723 15:71808077-71808099 ACCTCACAGCAGCCTTGTAAAGG - Intronic
1129039219 15:72671116-72671138 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129210602 15:74065811-74065833 TCCCAACAGCACCCTAGAAATGG - Intergenic
1129403408 15:75299518-75299540 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129727804 15:77910448-77910470 TCCCAACAGCACCCTAGAAATGG - Intergenic
1129840073 15:78738412-78738434 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129952169 15:79601499-79601521 TCTCCTCTGCAGCCTGGGGAGGG - Intergenic
1130030674 15:80310753-80310775 TCCTTACAGCAGCGTGAGAATGG - Intergenic
1130270671 15:82445344-82445366 TCCCCGCTACCGCCTGGGAAAGG - Intergenic
1130489659 15:84422121-84422143 TCCCCGCTACCGCCTGGGAAAGG + Intergenic
1130501250 15:84500883-84500905 TCCCCGCTACCGCCTGGGAAAGG + Intergenic
1131075032 15:89490159-89490181 TGCCCACTGCAGCCTGGCCAAGG + Intronic
1131286378 15:91062155-91062177 TCACCACAGCTGTCTGTGAATGG - Intergenic
1132185175 15:99797475-99797497 TCCCAACAGCACCCTAGAAATGG + Intergenic
1132186452 15:99806002-99806024 TCCCCGCTACCGCCTGGGAAAGG - Intergenic
1132390301 15:101433772-101433794 TCCCCACATCACCCTGAGCAAGG + Intronic
1132429226 15:101746708-101746730 TCCCCGCTACCGCCTGGGAAAGG + Intergenic
1132431813 15:101767080-101767102 TCCCAACAGCACCCTAGAAATGG - Intergenic
1132464207 16:70299-70321 TCCCACCTGCAGCCTGGGGAGGG - Intronic
1132643615 16:988953-988975 TCCCAGCAGCTGCCTGGGAGGGG + Intergenic
1132780300 16:1620712-1620734 TCCCTCCCTCAGCCTGGGAAAGG - Intronic
1132975348 16:2708421-2708443 TCCCCACAGCCAGCTGAGAAAGG - Exonic
1133281960 16:4671684-4671706 TCCCCAGGGCAGCCCAGGAATGG + Intronic
1133749839 16:8716099-8716121 TCCTCAGAGCAGCTTGGGGATGG + Intronic
1134006393 16:10821269-10821291 GGGCCCCAGCAGCCTGGGAAGGG + Intergenic
1136348229 16:29690581-29690603 TTCCCGCAGCATCCTGGGAAAGG - Intronic
1136513986 16:30756794-30756816 TCCACACTGCCACCTGGGAAGGG - Exonic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1138398733 16:56728993-56729015 TCTTCACAGCAGCATGAGAACGG - Intronic
1138502779 16:57458367-57458389 GGCCCACAGGAGGCTGGGAAAGG + Intronic
1138893219 16:61170539-61170561 TCTTCACAGCAGCATGAGAACGG - Intergenic
1139657333 16:68397001-68397023 TCCCCTAAGCAGCCTGGGGAGGG + Intronic
1140032298 16:71348474-71348496 CACCCACAGCAGCCGGGGAATGG + Intergenic
1140321771 16:73959506-73959528 ACCACACAGTAGCCAGGGAAAGG - Intergenic
1140540022 16:75748479-75748501 TCCCAAAAGCAACTTGGGAAGGG - Intronic
1140774301 16:78235897-78235919 TACCCACAGGAGCCTGGGCATGG + Intronic
1140900101 16:79359167-79359189 GCCCCACAGTAGCTGGGGAATGG + Intergenic
1141682479 16:85552765-85552787 TCCCCACTGCAGCAGGGGAAGGG + Intergenic
1142189305 16:88710342-88710364 GCCCCTCAGCAGGCTGAGAAGGG - Intronic
1142286402 16:89173233-89173255 TCCCCAGAGCAGGTGGGGAAGGG - Intronic
1142428954 16:90016135-90016157 GCCCCAGAGCAGGCTGGGACTGG + Intronic
1142743493 17:1943447-1943469 TCCCCGCAGCCCCCTGGGCAGGG + Intronic
1143400671 17:6640269-6640291 TCCCCGGCGCAGCCTGGGCAAGG + Intronic
1143486684 17:7259148-7259170 TCCCCAGAGCACCCTGGGCCTGG + Intronic
1143912716 17:10265193-10265215 TCCCCACAGCAGCCTAGGCAAGG - Intergenic
1144044481 17:11442569-11442591 TCCCCACAACAGCCTTCTAAGGG - Intronic
1144338962 17:14297442-14297464 TCTCCCCAGCGGACTGGGAAGGG - Intergenic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1144824142 17:18096226-18096248 TCCCCAAAGCGGCATGGCAAGGG - Intronic
1145259054 17:21343907-21343929 TGCACACAGCAGCCTGGGCCTGG - Intergenic
1145317564 17:21744096-21744118 TGCACACAGCAGCCTGGGCCTGG + Intergenic
1145736176 17:27233332-27233354 TCCTCATAGCAGCATGAGAACGG - Intergenic
1146638374 17:34522428-34522450 TCTCCTCAGCAGCCTGGGCTGGG - Intergenic
1146815334 17:35937668-35937690 TCCCACCCACAGCCTGGGAATGG - Intronic
1146912373 17:36657063-36657085 TTCCCTCCGCAGACTGGGAAAGG - Intergenic
1147266577 17:39238004-39238026 TCTCCAGAGGAGCCCGGGAATGG - Intergenic
1147912076 17:43861818-43861840 CCCCCTCAGGGGCCTGGGAAGGG - Exonic
1148353145 17:46955977-46955999 TCCTCACATCAGACTGGGAATGG + Intronic
1148443638 17:47725022-47725044 TAACCACAGTAGCCTGGGAAAGG - Intergenic
1149362630 17:55911111-55911133 TCCCCACACCAGGCTGCGAGGGG - Intergenic
1149973707 17:61245008-61245030 TCCTTACAGCAGCGTGAGAATGG - Intronic
1150304491 17:64072794-64072816 ACCCAACAGCATCCTAGGAATGG + Intronic
1150461738 17:65359357-65359379 TCTCCACAGCAGCGTGACAATGG - Intergenic
1151834585 17:76574444-76574466 CCCCCACAGCAGCACTGGAATGG + Exonic
1151927918 17:77212420-77212442 TCCCAAAAGCAGCCTGTGACAGG + Intronic
1151963499 17:77419541-77419563 TCCCCAGGGCTGGCTGGGAATGG + Intronic
1151980918 17:77507922-77507944 CCTGCACAGCAGCCTGGGAATGG + Intergenic
1152309073 17:79538174-79538196 TATTCACAACAGCCTGGGAAGGG - Intergenic
1152462797 17:80450205-80450227 TCCCCTCTGCAGCCTGGCCAAGG + Intergenic
1153514130 18:5889777-5889799 TGCCCACAGCTGCTTGCGAATGG - Exonic
1153651959 18:7248685-7248707 TCCCCACAGCAGCGTGGTCCAGG + Intergenic
1153756943 18:8293939-8293961 TCTTCACAGCAGCATGAGAATGG - Intronic
1155446157 18:25915116-25915138 TCCTTACAGCAGCGTGAGAACGG - Intergenic
1156397026 18:36707678-36707700 GCCCCCCAGCAGGCTGGGCATGG - Intronic
1156517644 18:37694623-37694645 TCTCCATAGCAGCATGAGAATGG - Intergenic
1157880448 18:51316575-51316597 TCCTCACAGCAGTGTGAGAAAGG + Intergenic
1159080004 18:63726119-63726141 TCCCCAGACCACCCGGGGAATGG - Intronic
1159789723 18:72763804-72763826 TCTTCACAGCAGCCTGACAACGG - Intronic
1160337982 18:78059828-78059850 CCCCCACACCAGCCTGTGAGGGG + Intergenic
1161399807 19:4062229-4062251 TCCCCCCAGCAGGCTGTGGACGG - Intronic
1161455259 19:4366716-4366738 TCCCCACAGCTGCCTGCCCACGG + Intronic
1161723782 19:5917213-5917235 GCCCCACAGCAGGGTGGGAAGGG + Exonic
1162786696 19:13039529-13039551 TCCTCACTGCACCCTGGGAGAGG + Intronic
1163063955 19:14779514-14779536 CCCCCACAGGAGCCCGGGACAGG - Intergenic
1163679000 19:18669839-18669861 TCCCCTCAGCAGCTTGGGATGGG - Exonic
1163813000 19:19445984-19446006 TTCCCACATGAGCCTGGGCAGGG - Intronic
1164159679 19:22618119-22618141 TCCCCACTGCAGCGTGGGTCTGG + Intergenic
1164446086 19:28318667-28318689 TCTCCAAAGCAGTGTGGGAAAGG - Intergenic
1164805545 19:31113502-31113524 TCACCACAGAAGAATGGGAATGG - Intergenic
1164841165 19:31393372-31393394 AGCTCAGAGCAGCCTGGGAAAGG + Intergenic
1166871267 19:45872546-45872568 TCCCCAGACAAGCCTGGCAAGGG + Exonic
1168104173 19:54156567-54156589 ACACCACAGCACCCCGGGAAAGG + Intronic
1168655475 19:58124499-58124521 TCCTCACAGCAGTGTGAGAATGG - Intergenic
925194183 2:1910131-1910153 TCCCTACAGCAGCAGGGGCAGGG - Intronic
925204932 2:1997556-1997578 TCCCAACAGGAGCCTGGGCAAGG - Intronic
926710042 2:15871994-15872016 TCCTTATAGCAGCATGGGAATGG + Intergenic
927237243 2:20885467-20885489 TCTTCACAGCAGCATGAGAATGG + Intergenic
927493527 2:23536597-23536619 TCGGCACAGCAGCCTGTGAAGGG + Intronic
927518823 2:23687325-23687347 TCCCACCACCAGCCTGGGACAGG + Intronic
928219811 2:29394478-29394500 TCCCCACAGCTCCCTGGTGAGGG - Intronic
928360552 2:30658968-30658990 CCTCTACAGCACCCTGGGAAGGG + Intergenic
929626048 2:43408185-43408207 ACCCCACAGCAGACTGCGACAGG + Intronic
929739314 2:44586920-44586942 TGCCAGCAGCAGCATGGGAAAGG + Intronic
929758561 2:44787792-44787814 TCCTCACAGCAGCCAGAGTAAGG - Intergenic
930335726 2:50042533-50042555 TCCTTATAGCAGCGTGGGAATGG + Intronic
931364086 2:61603719-61603741 TGCTCACAGCCCCCTGGGAAAGG - Intergenic
932260642 2:70324208-70324230 TCCCCTCAACAGGCTGGGCAAGG + Intergenic
932612298 2:73208717-73208739 TCCCCTCAACAGCCTGGCACAGG - Intronic
933609803 2:84422209-84422231 TCTCAGCAGCAGCCTGGGCATGG + Intergenic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
934554040 2:95278114-95278136 ACCACACAGCACCCTGGGCAGGG + Intronic
934936027 2:98465988-98466010 TCCCCCCAGTAGCTTAGGAAGGG + Intronic
935472776 2:103479789-103479811 TCCCTGCAGCAGGCTGGGGAAGG + Intergenic
935812525 2:106812724-106812746 TCCCCACATCAGTCTGGCATGGG - Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937921315 2:127133554-127133576 TCCCCTAAAGAGCCTGGGAAAGG + Intergenic
938494490 2:131786387-131786409 ATCCCACTGCAGCCTGGGCATGG + Intergenic
939811681 2:146840456-146840478 TCACCACAGCAGCGTGGGACTGG - Intergenic
939993692 2:148900503-148900525 TGCCAACAGAACCCTGGGAATGG + Intronic
940983028 2:160024283-160024305 GCCCCACAGCAGCTTGGCATGGG - Intronic
941573104 2:167196025-167196047 CACACACAGCAGCCTGGGAATGG - Intronic
944125558 2:196288997-196289019 TGCTCACAGCAGCCTGGAGATGG - Intronic
944415506 2:199475622-199475644 TTTCAACACCAGCCTGGGAAGGG - Intergenic
945031510 2:205668764-205668786 TCTTCACAGCAGCATGAGAAGGG - Intergenic
946727397 2:222674009-222674031 TCCTCACAGCAACCTGGTGAGGG + Intronic
946748505 2:222869640-222869662 TTGCCACAGTAGCCAGGGAATGG + Intronic
948073385 2:235145773-235145795 TCTTCACAGCAGCGTGAGAATGG - Intergenic
948633994 2:239322431-239322453 TCCCCACAACAGCCTACGGATGG - Intronic
948949027 2:241236942-241236964 TCCCCACAGCAGCCTCAAAGAGG + Intronic
1168810494 20:701569-701591 TCCATACAACAGCCAGGGAAAGG - Intergenic
1169190667 20:3657399-3657421 CCCCCACACCTGCGTGGGAATGG - Intergenic
1169666436 20:8041824-8041846 TCCCCCCAGTCGCCAGGGAATGG + Intergenic
1170659581 20:18323956-18323978 TCACCATAGCAGCCTGGGTTTGG + Intergenic
1170706283 20:18747368-18747390 TGGCCCCAGCAGCCTGGGCAGGG + Intronic
1170795521 20:19543588-19543610 TCCCCACAGCAGCAGAGGGAGGG + Intronic
1171057279 20:21919727-21919749 TCACAACAGCATCCTGAGAAAGG + Intergenic
1171094000 20:22314097-22314119 TCCTCAGAGCATCCTAGGAAGGG - Intergenic
1171388453 20:24786135-24786157 TCCCCTCAGCAGCCCGGTGAGGG + Intergenic
1172035758 20:32009993-32010015 TCACCACAGCAGCCTAGGGAGGG + Intergenic
1172359151 20:34300276-34300298 TCCCCACAGCAGCCAGAAGAGGG + Intronic
1173046852 20:39521028-39521050 TGCTCAGAGCAGCCTGGGCAGGG + Intergenic
1173733745 20:45345659-45345681 TCCCCACAACCGCCTGGGCCCGG + Intronic
1173971441 20:47155650-47155672 TCCTCACAGCAGCCCTGCAAAGG + Intronic
1174446573 20:50594915-50594937 TCCCCACAACAACCTGGGAGGGG + Intronic
1174507586 20:51026588-51026610 TCCACACAACAGCTTGGGGAAGG - Intergenic
1174703179 20:52629833-52629855 TCCTTATAGCAGCATGGGAATGG + Intergenic
1175477730 20:59288709-59288731 TCCACACAGGGGCCTGGCAATGG - Intergenic
1176043145 20:63076696-63076718 TCCCCACAGGAGGCTTGGCAGGG + Intergenic
1176285351 21:5016406-5016428 TCCTCACAGCAGGCTGGCAGGGG + Intergenic
1177589543 21:23144896-23144918 TCCACACAACAGCCTGGGTTTGG - Intergenic
1178775584 21:35547239-35547261 TCCTTACAGCAGCATGAGAATGG + Intronic
1179250769 21:39669644-39669666 ACCCCACAGCAGCCTCTGGAGGG + Exonic
1179655321 21:42841360-42841382 TCCCCCCAGGACCTTGGGAATGG - Intergenic
1179871830 21:44247069-44247091 TCCTCACAGCAGGCTGGCAGGGG - Intronic
1181302299 22:21889405-21889427 TCCCCACAGCTGCCTGTCATGGG - Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182107243 22:27698267-27698289 TCCCCGCACCAGCCTGGTGAGGG + Intergenic
1182546677 22:31080884-31080906 TCCCGAAAGCAGCCTAGGGACGG + Intronic
1183531088 22:38353741-38353763 TCTTCACAACAGCCTGTGAAGGG - Intronic
1183785436 22:40026586-40026608 CCCCCACAACACCGTGGGAAAGG - Intronic
1183966402 22:41445448-41445470 TACCCACCGTACCCTGGGAATGG - Intronic
1184169153 22:42748897-42748919 TCCCCACCTAAGCCTCGGAAGGG - Intergenic
1184175640 22:42787336-42787358 TCCCAACAGCACCCTAGTAATGG + Intergenic
1184601955 22:45549020-45549042 TCCCCTCAGCAGCCCCGTAAAGG + Intronic
1184855648 22:47145087-47145109 TTCTCACAGCAGCCTGGCAAGGG + Intronic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
949412475 3:3781156-3781178 TCCTCATAGCAGTGTGGGAACGG + Intronic
949930877 3:9077579-9077601 TTTCCACAGCAGCCTGGTGAGGG - Intronic
950128038 3:10522729-10522751 GCCTCACAGCAGCCTGGGGCAGG + Intronic
950838187 3:15940710-15940732 TCCTTATAGCAGCCTGAGAATGG - Intergenic
951060468 3:18201088-18201110 TCCTTATAGCAGCATGGGAATGG - Intronic
953885412 3:46712184-46712206 CACCCACAGCAACCTGGGCACGG + Exonic
954438827 3:50510561-50510583 TCCCCACAGCTGCCTAGCAGAGG - Intergenic
955088695 3:55728555-55728577 CCCCTAGAGGAGCCTGGGAAGGG + Intronic
955398054 3:58571252-58571274 TCCTAACAGCAGCCTGTGATGGG - Intronic
955730535 3:61980981-61981003 TCTTCACAGCAGCATGAGAACGG - Intronic
957243738 3:77691771-77691793 TCCTTATAGCAGCGTGGGAATGG + Intergenic
958727347 3:97921882-97921904 TCCCCACTGGGGCCTTGGAATGG + Intronic
958838878 3:99179063-99179085 TCTTCATAGCAGCATGGGAATGG - Intergenic
959031933 3:101309304-101309326 TCTCCACAGCAGCATGAGAATGG - Intronic
960003437 3:112756601-112756623 TCTTTACAGCAGCATGGGAATGG + Intronic
960495377 3:118367574-118367596 TCTTCATAGCAGCCTGAGAATGG - Intergenic
961497520 3:127305127-127305149 CCCCCACAGCAGCCAGGAACAGG - Intergenic
962530573 3:136276659-136276681 TCTCCACAGGAGCTTGGCAAAGG - Intronic
963849647 3:150198273-150198295 TCTACACAGCTGCCTGGCAAAGG + Intergenic
964239069 3:154570235-154570257 TCCTTACAGCAGCATGAGAATGG - Intergenic
964530753 3:157665153-157665175 TCCCCACATCAGCCAGGTTAAGG - Intronic
964892377 3:161552474-161552496 TCCCAACAGAAGCCCGGGAGAGG + Intergenic
965190769 3:165526339-165526361 TCTTCACAGCAGCATGAGAATGG - Intergenic
965792462 3:172404452-172404474 ACCTCACAGCTGCCTGGAAAAGG + Intergenic
967018819 3:185504761-185504783 TCTTCATAGCAGCCTGAGAAGGG + Intergenic
967231207 3:187338975-187338997 TCCTCACAGCAGCCTGAGAAGGG + Intergenic
967851225 3:194084023-194084045 TCCCCACAGCAATGTGAGAATGG + Intergenic
968460834 4:723977-723999 TCCTCACAGCTGCTGGGGAAGGG - Intronic
968567831 4:1323823-1323845 TCCCCACAGCAGCTTCAGACAGG - Intronic
969490809 4:7498285-7498307 TCCCCACATCAGCCAAGGCAGGG - Intronic
969586575 4:8097496-8097518 TCCTTACAGAAGCTTGGGAAAGG + Intronic
969601948 4:8181972-8181994 GCCCCACCCCACCCTGGGAAGGG - Intergenic
969612125 4:8233208-8233230 CCCTCTCAGCAGCCCGGGAAGGG + Intronic
969671931 4:8594405-8594427 TCCTCACTGGAGCCTGGGGACGG + Intronic
969700074 4:8763046-8763068 TGCCCACAGCGGCCTTGGCAGGG + Intergenic
970257289 4:14181828-14181850 TCTTCACAGCAGGCTGGGCATGG + Intergenic
971845692 4:31915554-31915576 TCTTCACAGCAGCATGAGAATGG + Intergenic
972711381 4:41598839-41598861 TCCCTACAGCAACTTGGGAGGGG + Intronic
972890641 4:43552727-43552749 TCTTCACAGCAGCATGAGAATGG + Intergenic
974334716 4:60526803-60526825 TCTTCATAGCAGCATGGGAATGG + Intergenic
976530204 4:86142966-86142988 TCCTCATAGCAGCATGAGAATGG - Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
976762312 4:88562875-88562897 TAACCAAAGCAGCCTGGGACGGG - Intronic
977584002 4:98755215-98755237 CACACACAGCAGCCTGGGGAAGG - Intergenic
977760707 4:100733333-100733355 ACCCCACAGCATCCTGATAAGGG + Intronic
978611187 4:110542325-110542347 TCACCAGGGCAGCCTGGGGAGGG - Intronic
978714493 4:111825166-111825188 TCCTTACAGCAGCATGAGAACGG + Intergenic
979851211 4:125573254-125573276 ACCCCACAGCAGCCTGTAAGCGG - Intergenic
980611647 4:135170015-135170037 ACCCCACAGCAGGCTTTGAAAGG - Intergenic
980654163 4:135760227-135760249 TCTTCATAGCAGCATGGGAATGG - Intergenic
981936220 4:150242686-150242708 TCCCCAAAGCAGCCAGAGACAGG + Intronic
982103189 4:151988908-151988930 ACACCAGAGCAGCCTGGGAAGGG - Intergenic
982509667 4:156265628-156265650 TCTTCACAGCAGCATGAGAATGG + Intergenic
983322253 4:166210599-166210621 TCTTCACAGCAGCATGAGAATGG - Intergenic
985179085 4:187237127-187237149 TCCACACAGCAAGCTGGGAGTGG - Intergenic
985712531 5:1437583-1437605 TCACCAGAGCAGCTTGGGATGGG - Intronic
985744662 5:1639197-1639219 GCCCCACAGCAGCCTCAGGAAGG - Intergenic
986303583 5:6498340-6498362 TCCTCATAGCAGCATGAGAATGG + Intergenic
986632641 5:9789163-9789185 TCAACCCAGGAGCCTGGGAAAGG + Intergenic
987084036 5:14452376-14452398 TCCCCCCAGCAGCCTGGTAAAGG + Intronic
987183027 5:15386280-15386302 TCCTCACAGCAGCTGTGGAAGGG - Intergenic
987354890 5:17054820-17054842 GACACACAGCATCCTGGGAACGG + Intergenic
988297875 5:29390252-29390274 ACCCCACAGCAGCCTGTAAGCGG + Intergenic
988416777 5:30955345-30955367 TCCCCTCATCAGGCTGGGCATGG + Intergenic
988729647 5:33958842-33958864 TCCTCACAGCAGCCTCTGAGTGG + Intronic
989399513 5:40993808-40993830 TCTTCACAGCAGCATGTGAAGGG - Intergenic
990475220 5:56156173-56156195 TCCAGACAGCAGGCTGTGAATGG + Intronic
990582220 5:57175318-57175340 ACCCTACAGGAGCCTGGAAAAGG - Intronic
990756899 5:59082131-59082153 TCTTCACAGCAGCATGAGAATGG + Intronic
990796860 5:59553287-59553309 TCACCACAGAAAGCTGGGAAAGG + Intronic
993065784 5:83095797-83095819 GTCCCACAGCAGACTGTGAAGGG - Intronic
993884157 5:93396837-93396859 TCTCCATAGCAGCATGAGAATGG + Intergenic
994539000 5:101070895-101070917 TCTTCACAGCAGCATGAGAATGG - Intergenic
995429573 5:112059080-112059102 CCCACAAAGCAGCCTGGGAGAGG + Intergenic
995805456 5:116047323-116047345 TCTACACAGAAGCCTGGGGAAGG - Intronic
996150180 5:120024559-120024581 TCCTTACAGCAGCCTGAGAATGG + Intergenic
996417125 5:123222573-123222595 TCTCAGCAGCAGCCTGAGAAGGG - Intergenic
997417683 5:133741531-133741553 CACCCATAGCAGCCAGGGAATGG + Intergenic
997614867 5:135239393-135239415 TCCCCCCAGCCTCATGGGAAGGG + Intronic
997733283 5:136195717-136195739 TCCGCACAGCAACCTGTGATAGG + Intergenic
998380125 5:141718345-141718367 TACCAAGAGTAGCCTGGGAAAGG - Intergenic
998632505 5:143915527-143915549 TCCCCACTGTAGGCTGGGATAGG - Intergenic
998852595 5:146365030-146365052 TCATCACGGCAGCCTGGCAAAGG + Intergenic
998984325 5:147739100-147739122 TGCTCACAGCAGCCTGGTGAGGG + Intronic
999309794 5:150544767-150544789 CACCCACAGCAGGCTGGGGAGGG + Intronic
999714855 5:154352451-154352473 TCTTCACAGCAGCCTTGTAAGGG + Intronic
1000813448 5:165890937-165890959 TCCCCAAAGCAGCGTGGGCTTGG - Intergenic
1000834421 5:166135945-166135967 ACCCCACAGCAGCCTGTAAGTGG - Intergenic
1001102232 5:168823880-168823902 TCCCCACAGCATCCTGTGCGAGG - Intronic
1004167098 6:13266497-13266519 TCTTCACAGCAGTGTGGGAATGG - Intronic
1005024127 6:21446654-21446676 TCCCCACAACAACCTGGGAAGGG - Intergenic
1006286758 6:33102167-33102189 TCACCAAAACAGCATGGGAATGG + Intergenic
1007153724 6:39721715-39721737 TCCCCACAGCAATCTTGTAAGGG - Intronic
1007590395 6:43017375-43017397 TCCCCACATCAGGGTGGGAACGG + Intronic
1009804780 6:68589664-68589686 TCTTCACAGCAGCATGAGAATGG - Intergenic
1010152989 6:72758082-72758104 TCCCCCAGGCAGCCAGGGAAGGG + Intronic
1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG + Intergenic
1011591243 6:88972534-88972556 TCCTCACCCCAGCCCGGGAAAGG + Intergenic
1012144193 6:95660893-95660915 TCTTCACAGCAGCATGAGAACGG + Intergenic
1012708271 6:102563548-102563570 TCTTCACAGCAGCATGAGAATGG - Intergenic
1014348857 6:120313368-120313390 TCTCTATAGCAGCCTGAGAACGG - Intergenic
1014639502 6:123892276-123892298 TCTTCACAGCAGCGTGAGAATGG - Intronic
1015844292 6:137503503-137503525 TCTTCACAGCAGCATGAGAATGG - Intergenic
1016388089 6:143548539-143548561 TCCACACACCAGCCTGGGCCAGG + Intronic
1018547684 6:164956167-164956189 TCCACACAAGATCCTGGGAAAGG + Intergenic
1019434984 7:1017888-1017910 TTCCTACCGCAGCATGGGAAAGG - Intronic
1019448089 7:1081746-1081768 TGCCCACTGCAGCCTGGGGGAGG + Intronic
1019625032 7:2011607-2011629 TCCTCCCAGGAGCCTGGGAGAGG - Intronic
1020001217 7:4757048-4757070 TCCCAGGAGGAGCCTGGGAAGGG + Exonic
1020151531 7:5685386-5685408 TCCCCACAGAAGCCCTGGGATGG + Intronic
1020461548 7:8434317-8434339 TTCCCACAGCTGCCTGAGGATGG - Exonic
1020464088 7:8456910-8456932 TCCCCACTGCAGCCTAGATAAGG + Intronic
1021936659 7:25638214-25638236 TCCCTGCAGCCTCCTGGGAAGGG - Intergenic
1021971399 7:25968867-25968889 TCGCCACAGCTGCATGGCAAAGG + Intergenic
1023116127 7:36864428-36864450 TCACCAAAGCTGCCTGGGAGGGG + Intronic
1024170691 7:46782130-46782152 TCACCAGAACAGCATGGGAAAGG - Intergenic
1024866619 7:53910590-53910612 TCCCCATTGCAGCCTAGGCAGGG - Intergenic
1025875779 7:65478686-65478708 CCACCACAGAGGCCTGGGAAGGG - Intergenic
1026230135 7:68475685-68475707 TGTACACAGCAGCCTTGGAAGGG + Intergenic
1026310547 7:69180134-69180156 TCCCCTCTCCAGCCTGAGAAGGG + Intergenic
1027048672 7:75007867-75007889 TCACCCCAGCAGCCTGGGGCCGG + Intronic
1027268634 7:76507899-76507921 TGCCCACAGAAGCCTGCGCACGG + Intergenic
1028404764 7:90463454-90463476 TCCTTACAGCAGCGTGAGAATGG + Intronic
1028752131 7:94393952-94393974 CCCCCACCGCAGCCTCAGAAAGG + Intergenic
1029303442 7:99601855-99601877 CCCTCACTGCAGCCAGGGAAGGG - Intronic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1031505546 7:122577238-122577260 TCTTCACAGCAGCGTGAGAATGG + Intronic
1031887821 7:127259185-127259207 TCCTTACAGCAGCTTGAGAACGG + Intergenic
1032889845 7:136182495-136182517 TCCCTGAAGCAGCCAGGGAAGGG - Intergenic
1034473841 7:151271209-151271231 TCACCCCACCCGCCTGGGAAAGG - Intronic
1035202718 7:157277389-157277411 TGCCCCCAGCAGCCCGGCAAGGG - Intergenic
1035826175 8:2646293-2646315 TCTTCATAGCAGCCTGAGAATGG - Intergenic
1036672026 8:10796453-10796475 TCCAGAGAGCAGCTTGGGAAAGG + Intronic
1037595946 8:20354234-20354256 TCTCCACAGGGGCCTGGGGATGG + Intergenic
1037686493 8:21144000-21144022 TCCCCACTGCAGCCTGATTAAGG + Intergenic
1037691637 8:21185969-21185991 TCCCCACAGCAGGCTGGAGTTGG - Intergenic
1039453281 8:37692762-37692784 TCCCCACAGCAGCCTGGTTCTGG + Intergenic
1039828061 8:41191619-41191641 GCCACACACCAGCCTGGGAATGG - Intergenic
1040566332 8:48571172-48571194 TCTCCATAGAAGACTGGGAATGG - Intergenic
1041123642 8:54612342-54612364 TCCCCACAGCTGCCTGCCATGGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1041897131 8:62938026-62938048 ACCCCACAGCAGCCATGGAAAGG + Intronic
1042700405 8:71606253-71606275 CCTGCACAGAAGCCTGGGAAAGG + Intergenic
1043419406 8:80083710-80083732 TCCCCATAGCAGTGTGAGAATGG + Intronic
1043737871 8:83769359-83769381 ACCCCACAGGAGCCTGGTACAGG - Intergenic
1045379597 8:101610194-101610216 TCCCCACAGCACTTTGGGAGGGG - Intronic
1047060297 8:121218292-121218314 TCTTCACAGCAGCGTGAGAATGG - Intergenic
1048252913 8:132882074-132882096 TGCCCACAGCAGCCTGGCAGGGG - Intronic
1048311342 8:133324650-133324672 TCCCCACAGTAGCCTGGCTCTGG - Intergenic
1048354478 8:133642018-133642040 TCCTCACAGCAGCCTCGGGAGGG - Intergenic
1048857892 8:138699668-138699690 TCCCCAGAACAGCCTGAGAATGG + Intronic
1049018962 8:139940962-139940984 CACCCACAGCAGCCTATGAAGGG + Intronic
1049383831 8:142331041-142331063 GCCCCACTGCAGCCCGGGCAGGG + Intronic
1049411625 8:142476232-142476254 TCCTCTCAGGAGCCTGGGGAGGG + Intronic
1049445365 8:142627995-142628017 TCAGCAAAGCAGCCTGGGAGTGG - Intergenic
1051148543 9:14056592-14056614 ACTTCACAGCAGCATGGGAAGGG - Intergenic
1051182651 9:14427636-14427658 TCCCCTCAGCACCCTGGAGAGGG - Intergenic
1052664495 9:31477556-31477578 TCAGCAAAGCAGCCTGAGAAGGG - Intergenic
1053423964 9:37998958-37998980 TTCCTCCAGCAGCCTGGGCAGGG - Intronic
1054783619 9:69189318-69189340 TCTCCACTGAACCCTGGGAAGGG + Intronic
1055063065 9:72090717-72090739 ACCGCACTGCAGCCTGGCAATGG + Intergenic
1055235893 9:74122903-74122925 TCACGAGAGCAGCATGGGAAAGG + Intergenic
1056850701 9:90081386-90081408 GTCCCCCAGCAGCCTTGGAATGG - Intergenic
1057786695 9:98093404-98093426 TCCTCACAGCAGCCCAGGAGAGG + Intronic
1057900185 9:98942672-98942694 TACCCACAACAGCCATGGAAAGG - Intergenic
1058076383 9:100656154-100656176 TCACCACAATAGCATGGGAAAGG - Intergenic
1060278560 9:122200338-122200360 TCCTCACAACAGCCTTGCAAGGG + Intergenic
1060608644 9:124940885-124940907 TCCCCACAGCGGCCCGGTCAGGG - Intronic
1060665233 9:125428647-125428669 TCCCCACAGGTGCCTGGGCTGGG - Intergenic
1061258618 9:129467121-129467143 TCCCCGCTGCAGCCTAAGAAGGG - Intergenic
1061574515 9:131497665-131497687 ACCCCAGAGCTGCCTGGGAAAGG + Exonic
1061843356 9:133373212-133373234 TCCCCTCAGTAACCTGGGAGAGG + Intronic
1062024199 9:134332881-134332903 TCAGCATGGCAGCCTGGGAAGGG + Intronic
1062092066 9:134683580-134683602 TACACACAACAGCCTGGGAGAGG - Intronic
1062097101 9:134709165-134709187 TCCCTACACCAGCGTGGAAAAGG + Intronic
1062117383 9:134816729-134816751 TCCCCACCACAACCTGGGCAGGG - Intronic
1062139399 9:134947566-134947588 CCACCCCAGCAGCCTGGGGAAGG + Intergenic
1062363421 9:136198009-136198031 GCCCCACAGCAGCCTAGGAAGGG + Intronic
1062436331 9:136548059-136548081 CCTCCCCACCAGCCTGGGAAGGG + Intergenic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1062610707 9:137372200-137372222 TCCCGCCAGCAGCCAGTGAAGGG + Intronic
1062618012 9:137406867-137406889 CCCCCTCAGCAGGCTGGGGACGG + Intronic
1185652405 X:1657885-1657907 TCCCTCCAGCAGTCTGGGAGGGG + Intergenic
1186131469 X:6470569-6470591 TCTCCACAGCAGCATCAGAAAGG - Intergenic
1186843918 X:13512258-13512280 TTCCCACAGCAGACTGTGAGGGG + Intergenic
1187556625 X:20358099-20358121 TATTCACAGCAGCCAGGGAATGG - Intergenic
1187932974 X:24311128-24311150 TCAACACAGCAGCCTGGGGCTGG + Intergenic
1188062607 X:25619067-25619089 TCTTCACAGCAGCATGAGAACGG - Intergenic
1190160640 X:48029170-48029192 ACCCCACACCAGCAGGGGAAGGG - Intronic
1190177749 X:48165500-48165522 AACCCACAGCATCCTGGGTAGGG - Intergenic
1190180427 X:48187107-48187129 AACCCACAGCATCCTGGGTAGGG + Intronic
1190196857 X:48327205-48327227 AACCCACAGCATCCTGGGTAGGG - Intergenic
1190199401 X:48347286-48347308 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190204553 X:48392483-48392505 AACCCACAGCATCCTGGGTAGGG - Intronic
1190205983 X:48402920-48402942 AACCCACAGCATCCTGGGTAGGG + Intronic
1190210390 X:48442114-48442136 AGCCCACAGCATCCTGGGTAGGG - Intergenic
1190654952 X:52603409-52603431 AGCCCACAGCATCCTGGGTAGGG - Intergenic
1190659942 X:52644920-52644942 AACCCACAGCATCCTGGGTAGGG + Intronic
1190663594 X:52677567-52677589 AACCCACAGCATCCTGGGTAGGG - Intronic
1190666168 X:52697768-52697790 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190673250 X:52760642-52760664 ACCCCACAGCATCCTGGGTAGGG - Intronic
1190675829 X:52780855-52780877 AACCCACAGCATCCTGGGTAGGG + Intronic
1191776883 X:64824064-64824086 TCCTCACTACAGCCTGGTAAGGG - Intergenic
1191779597 X:64850970-64850992 ACCCCACAGCAGCCTGTAAGCGG + Intergenic
1194253827 X:91612634-91612656 TCTTCACAGCAGCATGAGAATGG - Intergenic
1194843782 X:98777167-98777189 TCCTTACAGCAGCATGAGAATGG + Intergenic
1195325975 X:103758819-103758841 TCCTCACAGCAGTGTGAGAATGG - Intergenic
1195369587 X:104159702-104159724 TACCCACAGCAGCTGGGGGATGG - Intergenic
1197783114 X:130176117-130176139 TCCTGACATCAGCCTAGGAAGGG + Intronic
1198044254 X:132884414-132884436 TCCCCAGAGCAGCCTAGCATTGG - Intronic
1200572612 Y:4852211-4852233 TCTTCACAGCAGCATGAGAATGG - Intergenic
1201179560 Y:11332362-11332384 TCCCCACGGAAGCCTGGGGACGG + Intergenic