ID: 1136553526

View in Genome Browser
Species Human (GRCh38)
Location 16:30994649-30994671
Sequence GAGGCTGGGTGTTTGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 511}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136553526 Original CRISPR GAGGCTGGGTGTTTGTGGAG AGG (reversed) Intronic
900514878 1:3076894-3076916 GATGGTGGGTGTTTTTGGGGGGG + Intronic
900957123 1:5892879-5892901 GGGGCGTGGTGTTTGTGAAGGGG - Intronic
901002366 1:6155099-6155121 GAAGCTGGGTGTTTTGGGGGTGG - Intronic
901002378 1:6155139-6155161 GAAGCTGGGTGTTTTGGGGGTGG - Intronic
901029790 1:6300463-6300485 GAGATTCCGTGTTTGTGGAGAGG - Intronic
901029804 1:6300524-6300546 GAGATTCTGTGTTTGTGGAGAGG - Intronic
901029819 1:6300581-6300603 GAGATTCCGTGTTTGTGGAGAGG - Intronic
901029849 1:6300702-6300724 GAGATTCCGTGTTTGTGGAGAGG - Intronic
901029864 1:6300765-6300787 GAGATTCCGTGTTTGTGGAGAGG - Intronic
901078251 1:6569094-6569116 GAGGCAGGGTGGTTGGAGAGAGG + Intronic
901746030 1:11374297-11374319 GTGGATGGGTGTGTGTGGTGTGG + Intergenic
901807815 1:11749136-11749158 AAGGCTGGGTGAGTGGGGAGGGG - Intronic
902174656 1:14639994-14640016 AACGCTAGGTGGTTGTGGAGAGG + Intronic
902226281 1:14998389-14998411 GAGGCTGTGTGTATGTGGCGGGG + Intronic
902691908 1:18115268-18115290 GAGTCTGTGTGTGTGTGGTGGGG - Intronic
902813306 1:18901951-18901973 GCGGCGGGGTGTGTGGGGAGCGG + Intronic
902941720 1:19804872-19804894 CGGCCTGGGTGTTTGTTGAGTGG + Intergenic
902952306 1:19895441-19895463 GAGGCTGGGTATTGGGGGAGGGG - Intronic
903441641 1:23392773-23392795 GGGGCTGTGTATGTGTGGAGTGG - Intronic
903465865 1:23552449-23552471 GAGTCAGGGTGTATGTGGGGTGG + Intergenic
903542756 1:24106144-24106166 GAGTCTGGGTGTCAGTGGGGAGG - Intronic
903662562 1:24987253-24987275 GAGCCTGGGGGTTGGTGGGGAGG - Intergenic
903969026 1:27107156-27107178 GGGTGTGGGTGTGTGTGGAGGGG - Intronic
903969040 1:27107214-27107236 GGGGTTGGGTGTGTGTAGAGGGG - Intronic
903969045 1:27107233-27107255 AGGGCTGGGTGTGTGTGTAGGGG - Intronic
904041996 1:27590497-27590519 CAGGCTGGGTGTGTGCTGAGGGG - Intronic
904309103 1:29614198-29614220 GAGGCTGGATGTTGGAGGTGAGG + Intergenic
904373650 1:30066274-30066296 GAGGCTGGGGAGTGGTGGAGTGG - Intergenic
904470364 1:30732175-30732197 GGGGGTGGGCGTGTGTGGAGGGG + Intergenic
906191762 1:43903539-43903561 TAGGCTGGGTGGGTGTGGGGTGG + Intronic
906510481 1:46407886-46407908 AAGGCTGAGGGTTTGTGGACGGG + Intronic
906518814 1:46455569-46455591 GGGGGTGGGTGGTTGTAGAGGGG - Intergenic
906562266 1:46767880-46767902 GAGCCTGAGTGTGTGTGAAGTGG - Intronic
906566476 1:46804634-46804656 GAGGCTGGGTGCAGGTGGGGTGG + Intronic
906684073 1:47751721-47751743 GTGGCTGGGTGGGTGGGGAGGGG + Intergenic
907311468 1:53541377-53541399 GTGGCTGGGTGGGTGTGGGGAGG - Intronic
907784966 1:57602774-57602796 AATGCTGTGTGTGTGTGGAGGGG + Intronic
907848869 1:58235068-58235090 GAGGCAGGGTGTGTGGCGAGGGG - Intronic
908405451 1:63810054-63810076 AAGGCCAGGTGTTTGTGTAGGGG + Intronic
908544000 1:65147472-65147494 CAGGCTGGGTGGGAGTGGAGTGG + Intergenic
908652785 1:66354246-66354268 GCGGCTGGATTTTTGTGCAGAGG + Intronic
908731437 1:67230202-67230224 CAGCCTGGGTGTTAGGGGAGGGG + Intronic
910604952 1:89072833-89072855 TGGACTGGGTTTTTGTGGAGGGG - Intergenic
910863242 1:91764084-91764106 GACCCTGGGTGTGTGTGGGGGGG - Intronic
912697791 1:111854600-111854622 GAGGCTGGTTCTCTGAGGAGTGG + Intronic
914916853 1:151824289-151824311 GGGGCTGTGTGTGTGTGGTGGGG + Intronic
915099187 1:153486273-153486295 GAGGCAGGGGGTTTAGGGAGAGG - Intergenic
915113105 1:153577364-153577386 GAGCCAGGGTGATTGCGGAGCGG - Intergenic
916018732 1:160775016-160775038 GTGGTTAGGAGTTTGTGGAGTGG + Intergenic
917121815 1:171651345-171651367 GAGTCTGTGTGTGTGTGGGGGGG - Intronic
917186535 1:172362778-172362800 GGGGATGGGGGTTTGTGGATAGG - Intronic
920101861 1:203521891-203521913 GACGCTGGGTGATGGTGGAGGGG + Intergenic
920298139 1:204972155-204972177 CAGGCTGGCTATCTGTGGAGTGG + Intronic
920439074 1:205966564-205966586 GGGGCAGGGTGTCTGTTGAGAGG - Intergenic
920442427 1:205989814-205989836 GAGACTGGGAGTTTGAGGTGGGG - Intronic
921001845 1:211052173-211052195 GAGGCTGGGATTTTGTGGAAGGG - Intronic
921064638 1:211614020-211614042 GTGGCTGGGTAGGTGTGGAGAGG - Intergenic
921553227 1:216564969-216564991 CTGGCTGGGTGTGTGGGGAGGGG - Intronic
921592918 1:217024479-217024501 GTGGGTGGGTGGCTGTGGAGGGG - Intronic
922127394 1:222741609-222741631 GAGTCTGGGAGTTTGAGGTGAGG - Intronic
922158870 1:223063241-223063263 CATGCTGGCTGTGTGTGGAGGGG - Intergenic
922396478 1:225206704-225206726 GAGGCTATGTGTATGTGGTGAGG - Intronic
922488980 1:225999913-225999935 GAGGTTGGCTGTTTCTGGAGGGG - Intergenic
922698792 1:227745941-227745963 GAGACTGGGTGGATGTGGATGGG - Intronic
922787290 1:228289302-228289324 GAGGCAGGGTGACTGTGGGGAGG + Intronic
923109439 1:230879544-230879566 GAGGCAGGGTGATTGAGGAGGGG - Intergenic
923109482 1:230879664-230879686 GGGGCAGGGTGATTGAGGAGGGG - Intergenic
923109494 1:230879703-230879725 GGGGCAGGGTGATTGTGGAGGGG - Intergenic
923109544 1:230879853-230879875 AGGGCAGGGTGATTGTGGAGGGG - Intergenic
923109579 1:230879966-230879988 GACGCAGGGTGATTGAGGAGGGG - Intergenic
924910097 1:248500725-248500747 GAGGCTCGGTCTTTGTGTACTGG + Intergenic
924914005 1:248547322-248547344 GAGGCTCGGTCTTTGTGTACTGG - Intergenic
1063547665 10:6998161-6998183 AAGGCTGGGTGTTTAGGGTGGGG - Intergenic
1063644867 10:7869271-7869293 GTGTCTGTGTGTGTGTGGAGTGG + Intronic
1065180325 10:23118483-23118505 GAGGGTGGGTCTTTGGTGAGTGG + Intronic
1066316285 10:34250150-34250172 AAAGCTGTGTGTGTGTGGAGGGG - Intronic
1066369974 10:34812368-34812390 GTGGCTGGATAGTTGTGGAGTGG - Intronic
1066699657 10:38113569-38113591 GAGGGTGGGTGTTGCAGGAGGGG - Intronic
1067166313 10:43868933-43868955 GTGGCTTGGTGTTGCTGGAGAGG + Intergenic
1069735791 10:70653295-70653317 GAAGCTGGGAGCTTGTGGGGTGG - Intergenic
1069778033 10:70938106-70938128 GGGGCAGGGTCTTGGTGGAGTGG + Intergenic
1069783990 10:70976547-70976569 GGGGGTGTGTGTGTGTGGAGGGG + Intergenic
1070082776 10:73205329-73205351 GAGTGTGTGTGTGTGTGGAGAGG - Intronic
1070470952 10:76779023-76779045 GAGGCTCCGTGTTTGTTGAATGG + Intergenic
1070535455 10:77374082-77374104 GAGTCTGGGTGATTGTGGACAGG - Intronic
1071404708 10:85318728-85318750 GTGTCTGTGTGTCTGTGGAGTGG + Intergenic
1071497313 10:86178103-86178125 GAGATTTGGTTTTTGTGGAGTGG - Intronic
1072540711 10:96396151-96396173 GAGGCGCGGTGTTTGTGGGCTGG - Intronic
1073064887 10:100752344-100752366 GACGCTGGGTGGTTTGGGAGAGG + Intronic
1073081025 10:100860830-100860852 GAGGCTGGGTAATTGGGCAGAGG + Intergenic
1073164854 10:101437851-101437873 GACAATAGGTGTTTGTGGAGGGG - Intronic
1073215629 10:101834511-101834533 GAGGCGGGGTGATGGGGGAGAGG - Intronic
1073557985 10:104472083-104472105 GAAGCTGTGTGTGTGTGAAGGGG - Intergenic
1074229424 10:111518997-111519019 GGTGATGTGTGTTTGTGGAGAGG - Intergenic
1074647921 10:115485633-115485655 GACGTTGGGTGATTGAGGAGGGG - Intronic
1075093060 10:119454079-119454101 GGAGCTGGCTCTTTGTGGAGAGG - Intronic
1075686238 10:124367160-124367182 GAGGCTGGGTGGTTGCAGTGGGG - Intergenic
1075718444 10:124570623-124570645 GGGGCTGGGGGTGTGGGGAGTGG - Intronic
1076415898 10:130288281-130288303 TGTGCTGGCTGTTTGTGGAGGGG + Intergenic
1076776997 10:132703419-132703441 GAAGCTGTGTGTATGTGGGGGGG - Intronic
1077047629 11:553408-553430 GGTGGTGGGTGTCTGTGGAGGGG + Intronic
1077234064 11:1471453-1471475 GTGGCTGGGTGGGTGTGCAGCGG - Intronic
1077260557 11:1617120-1617142 GATGTTGGCTGGTTGTGGAGTGG - Intergenic
1077357768 11:2126668-2126690 TAGGTGGGGTGTTTGTGGATGGG + Intergenic
1077366298 11:2162649-2162671 AAGGCTGGGTGTGTGCAGAGCGG - Intergenic
1077573277 11:3356946-3356968 GAAGCTGGGTGGTTGGAGAGAGG + Intronic
1078668365 11:13344201-13344223 GGGCTTGGGTGTGTGTGGAGGGG - Intronic
1079130003 11:17741752-17741774 GAGGCTGGGTGGTTGGGGTTTGG - Intronic
1079373004 11:19868085-19868107 GGGGTGGGGTGATTGTGGAGGGG + Intronic
1079947022 11:26756843-26756865 GAGGCTGTGGGGTTGAGGAGAGG - Intergenic
1080639182 11:34148836-34148858 GAGGCTGGGAGGTGGGGGAGGGG + Intergenic
1081649759 11:44815887-44815909 GAGGCTGGGTGGCTGGGCAGAGG + Intronic
1082902685 11:58272788-58272810 GTGTCTGTGTGTCTGTGGAGAGG + Intergenic
1083291097 11:61690667-61690689 GAGGCTGCGTGTTTGTAGCTGGG + Intronic
1083666675 11:64279084-64279106 GAGACAGGGTGCTGGTGGAGTGG - Intronic
1083737040 11:64687353-64687375 GAAGCAGGCTGTGTGTGGAGGGG - Intronic
1084043807 11:66557614-66557636 CAGCCTGGGTGTGGGTGGAGAGG + Intronic
1084722921 11:70919746-70919768 GAAGCTGGGAGGTTGGGGAGAGG - Intronic
1084799520 11:71533241-71533263 GAAGCTGGCTATGTGTGGAGTGG + Intronic
1084872942 11:72109937-72109959 GAGGCTGGGTGTGGGTGGGGAGG + Exonic
1084947930 11:72648872-72648894 GAGGATGTGTGTCTGTGTAGAGG - Intronic
1085458575 11:76679540-76679562 GAGGCTGGGTGCTGGTGGGCTGG + Intergenic
1086563644 11:88198227-88198249 GGGGTAGGGTGTTTGTGGGGAGG + Intergenic
1087769753 11:102195444-102195466 GAGGCTGGGAGTTGGTGCTGGGG + Intronic
1087890849 11:103536571-103536593 GAGGCGGGGTAGTTGTGGATTGG + Intergenic
1088547774 11:110978246-110978268 GAGGCTGGGGAGTGGTGGAGGGG + Intergenic
1089183566 11:116599292-116599314 TGGCCTGGGTGTTTGTGGGGTGG - Intergenic
1089386989 11:118074923-118074945 GGGTCTGGGAGTTTGTGGAGAGG - Intergenic
1089596638 11:119584942-119584964 GGGGCTGGGGGTTTGTTTAGGGG + Intergenic
1089621639 11:119726131-119726153 GGGTCTGGGGGTTTGAGGAGAGG - Intronic
1090149657 11:124369462-124369484 GAGGATGGGTCTTTGATGAGAGG - Intergenic
1090312466 11:125753709-125753731 GAAGCAGCGTGTTTGTGGCGGGG + Intergenic
1090352199 11:126114778-126114800 AAGTCTGGGTGTGTGTGGTGGGG + Intergenic
1090473661 11:127001296-127001318 GTGGGTGGGTGGTTGTGGTGGGG + Intronic
1090780875 11:130005047-130005069 GAGGCCAGGGGTATGTGGAGTGG - Intergenic
1090964045 11:131582792-131582814 GGGGCTGGGTTTTTTTGGTGGGG - Intronic
1091372390 11:135071958-135071980 GAGGGTGTGTGTGTGTGGAGCGG - Intergenic
1091820137 12:3470189-3470211 GATGCTCTGTGTGTGTGGAGAGG + Intronic
1092258984 12:6942357-6942379 GAGGCTGGGTCTCAGTGCAGCGG + Intergenic
1092532972 12:9360479-9360501 GATGCTGTGTGTGTGTGGAGAGG - Intergenic
1094842901 12:34349382-34349404 GTGGCAGGGTGGGTGTGGAGGGG + Intergenic
1095472045 12:42547510-42547532 AAGGCTGTGTGTTTCTGGACAGG + Intronic
1095826243 12:46532322-46532344 GGGGCGGGGTGTGTGTGGTGGGG + Intergenic
1096465954 12:51847975-51847997 GAGGGTGGGTGTTAGGGGCGCGG + Intergenic
1096829100 12:54300770-54300792 AAGGCAGGGTGTGTGTGGGGGGG - Intronic
1096912461 12:54998094-54998116 GATGTTGGGTGTTGGGGGAGGGG - Intergenic
1097046140 12:56189159-56189181 GAGGCTGGGGGTGCGGGGAGAGG + Intronic
1097220699 12:57449278-57449300 GAGTCTGGTTGATGGTGGAGAGG - Exonic
1097277578 12:57823800-57823822 GTGGCTGGGTCTTCCTGGAGGGG + Intronic
1101820617 12:108181284-108181306 GCGGCTGCGTGTTTGTGTGGGGG + Intronic
1101955084 12:109205798-109205820 GGGGATGGGTGTGGGTGGAGGGG + Intronic
1102231539 12:111265854-111265876 GAGGCTGGGGGCCTGTGAAGAGG + Intronic
1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG + Intronic
1102583157 12:113904777-113904799 GAGGATGTGTGTGTGTGGAGCGG + Intronic
1102908916 12:116697647-116697669 GGGGCTGGGTGACTGTGGTGGGG - Intergenic
1104460350 12:128950874-128950896 GAGACTGGGAGTGTGGGGAGTGG + Intronic
1104795240 12:131512498-131512520 TAGACTGGGTGGTTGTGGGGAGG - Intergenic
1104834502 12:131779283-131779305 GCGGGTGGGTGTGTGTGAAGAGG + Intronic
1106157021 13:27168987-27169009 GTGGCTGTGTGTGTGTGGAATGG - Intronic
1106182348 13:27380540-27380562 GAGGCTGGGAGTGTGGAGAGAGG - Intergenic
1106591693 13:31103954-31103976 GGGGCAGGGTGTTGGTGGGGGGG + Intergenic
1107131005 13:36895391-36895413 GAGGCTAGATTTGTGTGGAGGGG + Intronic
1107722534 13:43263812-43263834 GGGACTGGCTGTGTGTGGAGTGG + Intronic
1108455817 13:50612405-50612427 GAGTCTGTGTTCTTGTGGAGGGG - Intronic
1111537396 13:89620688-89620710 CAGGCAGTGTGTATGTGGAGTGG + Intergenic
1112773165 13:102814123-102814145 GAGGCTGTGTGTGTGTGCTGTGG + Intronic
1113230965 13:108214805-108214827 CAAGCAGGGTGTTTGTGCAGCGG - Exonic
1113619446 13:111703012-111703034 GAGACTGGGTGAGTGTGGGGCGG + Intergenic
1113624975 13:111788273-111788295 GAGACTGGGTGAGTGTGGGGCGG + Intergenic
1114216677 14:20662417-20662439 GAGGCTTGGTGTATGTGGGAAGG + Intergenic
1114513939 14:23285721-23285743 GAGGGTGAGTGTCTGTGTAGGGG - Intronic
1118277431 14:64397997-64398019 GAGCCTGGGTGACTGTGTAGGGG + Intronic
1118690445 14:68333930-68333952 GAGGCTGGGGTGTGGTGGAGAGG - Intronic
1121025613 14:90613980-90614002 GAGGCTTGGTGGTGGTGGGGCGG + Intronic
1121109527 14:91303220-91303242 GAGGCAGGGTGTGTGGGGAGGGG - Intronic
1122068870 14:99192521-99192543 GGGCCTGGGTGTGTGTGGCGAGG - Intronic
1122346617 14:101064946-101064968 GAGGCTCTGTGCTTGTGCAGGGG + Intergenic
1124247518 15:28083901-28083923 GAAGCTGGGTGTTTTAGGAGGGG - Intronic
1124250668 15:28104729-28104751 GAGGGTGAGTGTATGTGAAGGGG + Intergenic
1124336962 15:28864737-28864759 GGAACTGGGTGTCTGTGGAGAGG + Intergenic
1124496222 15:30189068-30189090 GAGGCTGGGTGGGGGTGGAGGGG - Intergenic
1124747352 15:32349579-32349601 GAGGCTGGGTGGGGGTGGAGGGG + Intergenic
1125211588 15:37222377-37222399 GTGTGTGTGTGTTTGTGGAGGGG + Intergenic
1125509340 15:40284182-40284204 GAGCCTGGGTGTGGGTGGTGGGG + Intronic
1127496485 15:59517509-59517531 GAGGCTGGTTGATTGTGGTCAGG + Intronic
1131158746 15:90090836-90090858 GAGGCTGGGGCTTTGGAGAGAGG + Intronic
1131342961 15:91619884-91619906 GAGGCTGGGTGTCTGGAGAGGGG + Intergenic
1132691987 16:1185777-1185799 GAGGCGGGGTGTGTATGGGGCGG + Intronic
1132727531 16:1345449-1345471 GAGGCTGGGGGTTGCTGGGGAGG - Intronic
1132814049 16:1817568-1817590 GCTGCTGCGTGTTTGGGGAGAGG - Intronic
1133420496 16:5642615-5642637 GAGGCTGGGTGGCTGGGGAAGGG - Intergenic
1133908188 16:10040503-10040525 GTGGATGTGTGTTTGTGGTGTGG - Intronic
1135325862 16:21525565-21525587 GAGCCTGGGTGTGGGGGGAGGGG + Intergenic
1135839403 16:25860944-25860966 GAGGGAGGCTGTATGTGGAGGGG + Intronic
1135868950 16:26131157-26131179 GGGCCTGGGTGTAGGTGGAGAGG - Intronic
1135993670 16:27232568-27232590 GGGGCTGGGTGTGTCAGGAGCGG - Intronic
1135999944 16:27284772-27284794 GAGGCTGGGGGTTTGCACAGGGG + Intronic
1136316001 16:29455032-29455054 GAGGCGGGGCGTCTGTGGTGGGG + Intronic
1136430578 16:30194374-30194396 GAGGCGGGGCGTCTGTGGTGGGG + Intronic
1136553526 16:30994649-30994671 GAGGCTGGGTGTTTGTGGAGAGG - Intronic
1137008413 16:35299644-35299666 TAGGCTGGGTTTTTGTGGGAGGG + Intergenic
1137015113 16:35366578-35366600 TAGGCTGGGTTTTTGTGGGAGGG + Intergenic
1137509167 16:49082956-49082978 GAGGCTGGGTGGCTTTGGAGAGG + Intergenic
1137603068 16:49769663-49769685 GAGGTTGGGAGATTGTCGAGGGG - Intronic
1138100840 16:54251326-54251348 GAGGGTGGGAGTTAGGGGAGGGG + Intronic
1138117789 16:54374149-54374171 GAAGCCGGGTCTTTGGGGAGTGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139949746 16:70663175-70663197 GAGGCGGGGCGGCTGTGGAGGGG - Exonic
1140074803 16:71688706-71688728 AAGGCTGGGGATTGGTGGAGAGG - Intronic
1140843899 16:78868365-78868387 GGGGCTGGGAGTGAGTGGAGGGG + Intronic
1140908569 16:79430627-79430649 CAGGCCTGGTGTTGGTGGAGAGG + Intergenic
1141826683 16:86485607-86485629 GAGGCTGGGTGGGTGTGGCTGGG - Intergenic
1142888922 17:2930286-2930308 GGGGCTGGGGGTCTGGGGAGGGG + Intronic
1143490901 17:7284739-7284761 TACCCTGGGTGTTGGTGGAGGGG - Intronic
1144708370 17:17384646-17384668 CAGGTTGGGTGTGTGTGGACTGG - Intergenic
1145288021 17:21521022-21521044 GAGGGTGGGTATTTAGGGAGCGG - Intergenic
1145389622 17:22445422-22445444 GAGGGTGGGTATTTAGGGAGCGG + Intergenic
1145783663 17:27580388-27580410 GAGGAAGGGTGTTTGAAGAGGGG + Intronic
1147009581 17:37434354-37434376 GAGGCAGGGTGTATGTGGGAAGG + Intronic
1147256299 17:39184386-39184408 GGGGGTGGGGGTTTGTGGGGAGG + Intronic
1147314232 17:39611964-39611986 GGGGCAGAGTGTGTGTGGAGGGG + Intergenic
1147446127 17:40476221-40476243 GAGGCTGGGTGGGGGTGGGGTGG + Exonic
1147627161 17:41907638-41907660 TGGGATCGGTGTTTGTGGAGGGG - Intronic
1148083649 17:44981029-44981051 GAGACAGGGTGCTTGAGGAGGGG + Intergenic
1148497608 17:48062647-48062669 GAGACTGGGGAGTTGTGGAGAGG - Intergenic
1149565154 17:57636005-57636027 GAGGGTTGGTGTCTGAGGAGAGG + Intronic
1149667828 17:58378212-58378234 GAGGCTGGGGAATTGTCGAGAGG + Intronic
1149864284 17:60141874-60141896 GAGGCTGGGGTTTAGGGGAGCGG - Intergenic
1151343218 17:73485183-73485205 TAGGGTGTGTGTATGTGGAGAGG + Intronic
1151370289 17:73643336-73643358 GATGCTGGGTGTGGGTGGATGGG + Intronic
1151468915 17:74305553-74305575 GAGCTCGGGTGTTTGTGGAAAGG - Intronic
1151767032 17:76137948-76137970 AAGGCTGGGTGGATGTGGACAGG + Exonic
1151891006 17:76950164-76950186 GATGCTGAGAGTTGGTGGAGGGG + Exonic
1151971596 17:77460280-77460302 GGGCCCTGGTGTTTGTGGAGTGG + Intronic
1152613853 17:81329060-81329082 GAGGCTGTGGCTTTGAGGAGAGG - Intronic
1152695596 17:81742208-81742230 GTGGGGGGGTGTTTGTAGAGGGG - Intergenic
1154124307 18:11675890-11675912 GAGGCTGTGTATGTGTGGGGTGG + Intergenic
1154273882 18:12942967-12942989 GTGTCTGGGGGGTTGTGGAGTGG + Intergenic
1155083754 18:22435127-22435149 GAGGCGGGGTGTTGATGGACAGG + Intergenic
1156345721 18:36255564-36255586 GAGGAAGGGTCTTTGTGGACAGG + Intronic
1156632218 18:38983906-38983928 GAGGCTGGGACTTTTTAGAGTGG - Intergenic
1157559892 18:48638600-48638622 AGGGCTGGGGGCTTGTGGAGTGG + Intronic
1157564455 18:48670489-48670511 GAAGCTGTGTGTGTGTGGGGGGG - Intronic
1157620951 18:49017250-49017272 CAGGGTGTGTGTGTGTGGAGGGG + Intergenic
1157662662 18:49459780-49459802 AAGGGTGGGTGTTTGTGAACTGG - Intronic
1158415522 18:57246788-57246810 GAGAATGGGTGTGGGTGGAGTGG - Intergenic
1158499449 18:57987029-57987051 GAGGCTGGGTGTTGCAGGATGGG - Intergenic
1158848346 18:61468430-61468452 GAGTGTGTGTGTTTGGGGAGGGG + Intronic
1159009289 18:63042977-63042999 GAGGATGGGGGTTTAGGGAGAGG + Intergenic
1160288884 18:77572209-77572231 GAGGCTGGGTGGGTGAGCAGGGG + Intergenic
1160390756 18:78530090-78530112 GAGGCTGTGCCTGTGTGGAGGGG + Intergenic
1160438208 18:78867328-78867350 GAGGCTGGAGGTGTGTGGCGGGG + Intergenic
1160855324 19:1214714-1214736 GAGCCTGGGTGGGTGTGGGGTGG + Intronic
1161847517 19:6720256-6720278 GAGTTTGGGTGTTTGTGGTTGGG - Intronic
1161847530 19:6720336-6720358 GAGTTTGGGTGTTTGTGGTTGGG - Intronic
1161910239 19:7188028-7188050 GAGCCTGGGTGTGTGTGGGTGGG - Intronic
1162223939 19:9203981-9204003 GAGGGTGGGGGTTTATGGGGTGG + Intergenic
1164393165 19:27843136-27843158 GAGTTTAGGTGTTTGTTGAGGGG + Intergenic
1164619677 19:29687198-29687220 GGGGCTGGGTGAGTGTGGATAGG + Intergenic
1164674687 19:30093339-30093361 GAGGGTGGGTGTGTGTGGTGTGG - Intergenic
1165866987 19:38945444-38945466 GAGTCTGGGTGGTCCTGGAGTGG + Intronic
1166140605 19:40803238-40803260 GAGTCTGGCAGTTTGGGGAGGGG + Intronic
1167100863 19:47403544-47403566 GAGGCTGGGTCTGTGGAGAGGGG + Exonic
1167320820 19:48796339-48796361 GAGGCTGGCTGTTAGTCCAGGGG + Intronic
1167354086 19:48992857-48992879 GAGGCTGTGTCCTTGAGGAGGGG - Intronic
1167412138 19:49350841-49350863 GAGGCAGGGTGTGTGTGTTGGGG - Intronic
1168241153 19:55089500-55089522 CAGGCTGGGGGTTGGTGGTGAGG - Intergenic
1168717901 19:58539827-58539849 GAAGCAGGGTGTGTGGGGAGGGG - Intergenic
925155744 2:1647983-1648005 GTGGCTGCGTGGTTGTGGGGAGG - Intronic
925164993 2:1710539-1710561 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165004 2:1710586-1710608 GAGAGTGGGTGCTGGTGGAGAGG - Intronic
925165043 2:1710759-1710781 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165055 2:1710806-1710828 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165067 2:1710853-1710875 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165100 2:1710994-1711016 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165114 2:1711056-1711078 GAGAGTGGGTGCTTGTGGAGCGG - Intronic
925165124 2:1711105-1711127 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165136 2:1711154-1711176 GAGAGTGGGTGCTGGTGGAGCGG - Intronic
925165148 2:1711201-1711223 GAGAGTGGGTGCTGGTGGAGCGG - Intronic
925165162 2:1711263-1711285 GAGAGTGGGTGCTGGTGGAGCGG - Intronic
925165178 2:1711327-1711349 GAGAGTGGGTGCTGGTGGAGCGG - Intronic
925165192 2:1711389-1711411 GAGAGTGGGTGCTTGTGGAGCGG - Intronic
925165202 2:1711438-1711460 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165214 2:1711485-1711507 GAGAGTGGGTGCTGGTGGAGCGG - Intronic
925165225 2:1711532-1711554 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165236 2:1711581-1711603 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925165252 2:1711645-1711667 GAGAGTGGGTGCTGGTGGAGTGG - Intronic
925363248 2:3294409-3294431 GAGGGTGTGTGTGTGTGGAGAGG - Intronic
925363256 2:3294444-3294466 GAGGGTGTGTGTTTGGAGAGAGG - Intronic
925363299 2:3294642-3294664 GAGGGTGTGTGTTTGGAGAGAGG - Intronic
925363407 2:3295189-3295211 GAGGGTGTGTGTGTGTAGAGAGG - Intronic
925363499 2:3295623-3295645 GAGGGTGTGTGTATGTAGAGAGG - Intronic
925363518 2:3295723-3295745 GAGGGTGTGTGTATGTAGAGAGG - Intronic
925363643 2:3296307-3296329 GAGGGTGTGTGTGTGTAGAGAGG - Intronic
925363662 2:3296416-3296438 GAGGGTGTGTGTTTGCAGAGGGG - Intronic
927446418 2:23165893-23165915 CAGGCTGAGTGTTTGGGGAAGGG - Intergenic
929026428 2:37607888-37607910 GAGCCTGTGTGTGTGTGGGGAGG - Intergenic
929120474 2:38480205-38480227 GAGGCTGGGTCTATATGGAGTGG - Intergenic
929500929 2:42491284-42491306 GAGGGAGGGTGTTTTGGGAGAGG - Intronic
930003472 2:46877761-46877783 GTGAGTGGGTGTGTGTGGAGTGG - Intergenic
931828596 2:66027172-66027194 GAGGCTGAGGGGTAGTGGAGGGG - Intergenic
932521355 2:72416744-72416766 GAGTGTGTGTGTTTGTGGAGAGG - Intronic
933051741 2:77610269-77610291 GAGGCAGGGTGTTTGTACTGGGG - Intergenic
933284472 2:80370348-80370370 AGGGCTGTGTGTTTGTGGAAAGG + Intronic
933285708 2:80382559-80382581 GAGGCTGGGTTTCTGTGAACTGG + Intronic
934647304 2:96066467-96066489 GAGGCTGGGGCTGTGTGGTGGGG - Intergenic
935984559 2:108660199-108660221 GAGGCTGGGAAGTTGTGGAGGGG - Intronic
936070728 2:109369565-109369587 GAAGCTGGGGGTTGGGGGAGAGG + Intronic
936136996 2:109903847-109903869 GAGGCTGGGAAGTTGTGGAGGGG - Intergenic
936207701 2:110467638-110467660 GAGGCTGGGAAGTTGTGGAGGGG + Intronic
936432068 2:112473415-112473437 GCATGTGGGTGTTTGTGGAGGGG + Intergenic
936561032 2:113540223-113540245 AAGAATGGGTGTTTTTGGAGGGG - Intergenic
937042698 2:118834314-118834336 GACCCTGGGTGTTGGTGGAGGGG - Intergenic
937191429 2:120104041-120104063 GAGCCTGGATGGTTGGGGAGTGG - Intronic
937270717 2:120649859-120649881 GAGGCTGGCTGGGTGTGGTGTGG - Intergenic
938081655 2:128373456-128373478 GGGGCTGTGTGTGTGTGGGGTGG - Intergenic
938230828 2:129657314-129657336 GAGGCTGTGTGTGTGTGTGGCGG - Intergenic
938293378 2:130162107-130162129 GAGGGTGGGAGTTTCTGGTGCGG - Intronic
938463175 2:131510854-131510876 GAGGGTGGGAGTTTCTGGTGCGG + Intergenic
939037068 2:137145406-137145428 GAGGCAGGATGTTTCTGGATAGG + Intronic
941001347 2:160206415-160206437 GGTGCTGGGGGTTGGTGGAGGGG - Intronic
941517812 2:166501624-166501646 GTGGGTGTGTGTTTGTGGTGAGG - Intergenic
943983717 2:194591564-194591586 GAGAATGGGGGTTTGAGGAGAGG - Intergenic
944632715 2:201643275-201643297 GGGGGTGGGTGTGTGTGGGGGGG - Intronic
944734066 2:202545214-202545236 GAGGCCAGGTGTGTGGGGAGGGG - Intronic
944866782 2:203870428-203870450 GAGGCTGGGGGTGTGGAGAGGGG + Intronic
945188801 2:207166106-207166128 GAGGGAGGGAGTTTGGGGAGGGG - Intronic
946444549 2:219727096-219727118 GGGCCAGGGTGTTTGTGGAAGGG + Intergenic
946507440 2:220317113-220317135 GAGGCTCAGTGTTTGGGGTGGGG - Intergenic
946591647 2:221255986-221256008 GGGGCGGGGTGAGTGTGGAGGGG - Intergenic
946711619 2:222512392-222512414 GAGGTTGTGTGTATGTGGCGTGG - Intronic
947068572 2:226259512-226259534 GCAGCAGGGTGTGTGTGGAGGGG - Intergenic
947749644 2:232525600-232525622 GTGGCTGGGTGTGTGTGGGTGGG + Exonic
948061831 2:235047916-235047938 GAGGGTGGTTGTTTTGGGAGTGG + Intronic
948203135 2:236144112-236144134 GGGGGTGGGTGTCTGTGGCGGGG - Intergenic
948691888 2:239711433-239711455 CAGGCTGGGTGTTGGTGGCCAGG - Intergenic
948907242 2:240985794-240985816 GTGCCTGGGTGTGTGTGGAGTGG - Intronic
1169110765 20:3032153-3032175 GAGGCTGGTTGTTTGGGGGTGGG - Intronic
1169446138 20:5672452-5672474 GAGGCCGGGGGTGTGGGGAGAGG + Intergenic
1170510080 20:17067471-17067493 GAGTCTGGGTGTTGGGAGAGGGG + Intergenic
1170914206 20:20606634-20606656 GAGGCTGGGAGGTGGTGGTGGGG - Intronic
1171192721 20:23170596-23170618 GAGGATGGGTGTTTCTGGCAGGG - Intergenic
1171421608 20:25021311-25021333 GAGGCTCGAGGCTTGTGGAGAGG - Intronic
1171494959 20:25548925-25548947 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171494991 20:25549025-25549047 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495009 20:25549075-25549097 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495027 20:25549125-25549147 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495045 20:25549175-25549197 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1171495081 20:25549275-25549297 GAGGCTGGGTGTGGGAGGTGTGG - Intronic
1172129338 20:32645376-32645398 CAGGCTGGGGGTGTATGGAGGGG + Intergenic
1173106822 20:40144711-40144733 GAGGGGGAGTGTGTGTGGAGGGG + Intergenic
1173349560 20:42232651-42232673 GAGGCGAGGTGTTTGGGGACAGG - Intronic
1173387791 20:42604880-42604902 GAGGCTTGGTGTGTGCTGAGAGG + Intronic
1173771963 20:45667430-45667452 AAGTCTGGGTGATTGTGGAGTGG + Intronic
1174136860 20:48385764-48385786 GTGGGTGTGTGTGTGTGGAGGGG + Intergenic
1175278497 20:57787764-57787786 CAGCCTGGGTGTCTGGGGAGGGG - Intergenic
1175310630 20:58009374-58009396 GAGGCAGTGGGGTTGTGGAGGGG - Intergenic
1175950668 20:62581514-62581536 CAGGCTGGGTGGTGGTGGTGGGG - Intergenic
1176841305 21:13845422-13845444 GAGCCTGGGTTTCTCTGGAGAGG + Intergenic
1177816875 21:25987323-25987345 AAGTCTAGGTTTTTGTGGAGGGG - Intronic
1177864856 21:26500421-26500443 GAGTCTGAGTCTTTGTGGAGCGG + Intronic
1178137504 21:29643878-29643900 GAGGTAGGATATTTGTGGAGGGG + Intronic
1179507489 21:41851546-41851568 GAGGCAGTGTGTGTGTGGCGGGG + Intronic
1179529424 21:42009203-42009225 GAGGCGGGGTGTTTTTAGACAGG - Intronic
1179933793 21:44590351-44590373 GAGGCTGGGGGTGTGGGGACAGG + Intronic
1180047218 21:45313328-45313350 GAGGCTGCATGTTTGTGGTGGGG + Intergenic
1180086766 21:45511039-45511061 GGGTGTGGGTGTTTGTGGGGGGG - Intronic
1180559439 22:16602815-16602837 GGTGCTGGGTGTTGGGGGAGGGG - Intergenic
1181100254 22:20534169-20534191 GAGGCTGGCTGTGTAAGGAGTGG - Intronic
1181898203 22:26129785-26129807 GAGGCAGGATGTCTGTGGATAGG - Intergenic
1182613310 22:31567550-31567572 GTGTCTGTGTGTTTGTGGAGGGG + Intronic
1183109868 22:35641160-35641182 GAGGGTGGGGGCCTGTGGAGGGG - Intergenic
1184288969 22:43488108-43488130 GAGTCTGGCTGTTCCTGGAGAGG + Intronic
1184873866 22:47260095-47260117 AAGGCTGGGGGTTTGTGGGAGGG + Intergenic
1185156704 22:49197381-49197403 GAGGCTGAGGGTTTCTGGGGGGG - Intergenic
1185249320 22:49791683-49791705 GAAGATGGGGGTCTGTGGAGAGG - Intronic
1185409264 22:50673959-50673981 GAAGCTGGGGGTCGGTGGAGTGG + Intergenic
949294718 3:2507880-2507902 GAGGGGGTGTGTGTGTGGAGAGG - Intronic
950633604 3:14299785-14299807 GGGGGTGGGTGTTGGTGGTGAGG - Intergenic
952291965 3:32025885-32025907 GAGTCTGTGTGTGTGTGCAGCGG - Intronic
952972130 3:38658159-38658181 GTGTGTGGGTGTGTGTGGAGTGG + Intergenic
954090865 3:48282973-48282995 GAGGCTGGTTGTTTGTCCAATGG - Intronic
954681481 3:52348468-52348490 GCAGCTGGGTGTGTGTGCAGTGG - Intronic
955441322 3:58958190-58958212 GGGGCTGGGAGTTTGAGTAGAGG - Intronic
955913865 3:63886238-63886260 GAGGCTGGGAGTTGGGGGAGTGG + Intronic
956446047 3:69326877-69326899 GAGGCTGTTTCTTTCTGGAGAGG - Intronic
956957143 3:74353945-74353967 GAGGCTGGGAGTGGGTGTAGAGG - Intronic
957132453 3:76240071-76240093 GAAGCTCTGTGTTTCTGGAGTGG + Intronic
960049496 3:113226451-113226473 GAGGCTGGCTTTTTCTGGAGAGG - Intronic
960119540 3:113933216-113933238 GAGGCTGGGTGTTTTTATATTGG + Intronic
960179086 3:114553357-114553379 GAGGCTAAGTGTTCATGGAGTGG - Intronic
960255843 3:115510675-115510697 GGGGGTGGGTGGGTGTGGAGAGG + Intergenic
961165435 3:124760265-124760287 GAAGCTGGGGGTTTGTCCAGTGG - Intergenic
961639834 3:128358195-128358217 GTGGCTGGGTGTGTGGGGACAGG + Exonic
961641994 3:128370626-128370648 GAGGGTGGGTGGTCGGGGAGAGG - Intronic
961667124 3:128499380-128499402 GTGGCTGGGTATGTGTGCAGGGG - Intergenic
961737191 3:129009835-129009857 GATGCTGGGTGCTTTGGGAGTGG + Intronic
962208463 3:133455718-133455740 GATGGTGGGGGTTTGGGGAGGGG - Intronic
962357338 3:134706023-134706045 GAGGTTTGGTGGTGGTGGAGGGG + Intronic
962776658 3:138667416-138667438 GAGGCTGTGTGTGTGTTGTGGGG + Intronic
963038072 3:141049622-141049644 CAGGCTGGGTGTGTGTGTGGAGG - Intergenic
963142299 3:141956917-141956939 GGGGCAGGGTGGTGGTGGAGGGG - Intronic
963290403 3:143481364-143481386 GAGGGTGGGTGGATGTGGAAAGG + Intronic
964003763 3:151807045-151807067 GAAGCTGGGTGGTTGGAGAGGGG - Intergenic
964896966 3:161610118-161610140 GAGGCAGAGTGTTTGAGGTGGGG - Intergenic
966061395 3:175760710-175760732 GATACTGGGTGTGTCTGGAGAGG + Intronic
967746465 3:193061217-193061239 GAGGGTGTGTGTGTGTGTAGGGG + Intergenic
967841809 3:194010963-194010985 GAGGCTGTGAGTCTTTGGAGTGG - Intergenic
967907543 3:194514133-194514155 GAGGATGTGTGTATGTGGGGTGG - Intergenic
968495598 4:913875-913897 GGGGCTGTGTGTGTGTGGGGGGG - Intronic
968740520 4:2328389-2328411 GAGGCTGGGGGTGTGGGGAATGG + Intronic
969376432 4:6766554-6766576 CTGGCTGGGGGCTTGTGGAGGGG - Intergenic
969462676 4:7337047-7337069 GAGGCTGGCTTTTTGTGCCGAGG + Intronic
969494217 4:7516648-7516670 GAGTCTGGGAGTGTGGGGAGAGG + Intronic
971745234 4:30571095-30571117 AAGGCTGGGGGCTTGTTGAGGGG + Intergenic
971791151 4:31171512-31171534 GTGGATGGGTGTGTGTGTAGGGG - Intergenic
972382912 4:38535987-38536009 GAGGCGGGGTGGGTGGGGAGGGG - Intergenic
972514759 4:39801203-39801225 AAGTCTGGGTGATGGTGGAGTGG - Intergenic
972947889 4:44280390-44280412 AAAGCTGAGTGTTTGAGGAGAGG - Intronic
974833530 4:67218280-67218302 GAGGCTGGGGGTAGGTGGAATGG - Intergenic
976213275 4:82692730-82692752 CAGGCTGGGTGGTTTTTGAGAGG - Intronic
976911592 4:90313624-90313646 GAGGTGGGGTGTGTGGGGAGAGG + Intronic
977325154 4:95565426-95565448 AAGACTGGGTGGTTGTGGGGAGG - Intergenic
979626101 4:122847350-122847372 GAAGCTAGGAGTCTGTGGAGTGG + Intronic
980076649 4:128301089-128301111 GAGGCTGGGAGTCTAGGGAGTGG - Intergenic
982328467 4:154155281-154155303 GGGGCTGGGTGTTGGAGGAAGGG - Intergenic
985261703 4:188120382-188120404 AAGACTGGGTTTTTGTGGTGAGG + Intergenic
985668386 5:1193531-1193553 AGGGCTGGGTGTGGGTGGAGGGG + Intergenic
986222386 5:5780531-5780553 TAGGCTGTGTGTGTGTGAAGGGG + Intergenic
986338880 5:6773883-6773905 GCGGCGGGGGGTGTGTGGAGCGG - Intergenic
987104889 5:14628885-14628907 GAGGCTGAGGGTTTGGGGAATGG - Intergenic
987348943 5:17004268-17004290 GTGTGTGGGTGTTTGGGGAGGGG - Intergenic
988370935 5:30366078-30366100 GATCCTCAGTGTTTGTGGAGGGG - Intergenic
988597178 5:32605927-32605949 GAGGCTGGTTGAGTGAGGAGTGG + Intergenic
988961821 5:36378527-36378549 GAGGGAGGGTGTGTGAGGAGAGG - Intergenic
989440507 5:41466697-41466719 GAGGCAGGGAGTTGGTGGGGAGG - Intronic
990141303 5:52707255-52707277 GAGGATGCATGTTTGTGTAGAGG - Intergenic
993181351 5:84557169-84557191 GAGACTGTGTGTTATTGGAGAGG + Intergenic
994110230 5:95994454-95994476 GAGGCTGGGTGTTAGGGGGAGGG + Intergenic
996349264 5:122520256-122520278 GAGGCTGGAAGTTGGTGGAGTGG - Intergenic
998603017 5:143604320-143604342 CATGTTGGGTATTTGTGGAGTGG + Intergenic
999240483 5:150124656-150124678 GAGGCTAAGTGTGTGGGGAGGGG + Intronic
999305523 5:150517101-150517123 GAAGCTGTGTGTGTGTGCAGGGG - Intronic
999370236 5:151050767-151050789 GAGGGTGGGGGTGTGTGGTGGGG - Intronic
1000335293 5:160237585-160237607 GAGGCTGGGGCTTGGTGTAGGGG - Intronic
1000627240 5:163553345-163553367 GAGGCTGTGTGTGGATGGAGGGG - Intergenic
1001560949 5:172668596-172668618 GTGGCTGGGTGTGGGAGGAGTGG + Intronic
1001993006 5:176133309-176133331 GGGGCAGGGTGATTGTGGGGCGG + Intergenic
1002189170 5:177469908-177469930 GAGGCTGGGGCTGTGAGGAGGGG + Intronic
1002590868 5:180291309-180291331 GAGGCTGGGCGGGTGGGGAGGGG + Intronic
1002607477 5:180391626-180391648 GAGGCTGGGGGTTTGGTAAGGGG - Intergenic
1002915861 6:1527243-1527265 GAAGGAGGGTGTGTGTGGAGGGG - Intergenic
1003534765 6:6967133-6967155 GAAGCTGGGTGTGTAAGGAGTGG - Intergenic
1003904466 6:10686414-10686436 GAGGAGGGGTGTGTGTGGGGGGG + Intronic
1005278188 6:24242520-24242542 GAGGCTGGCGGTGGGTGGAGTGG - Intronic
1005401549 6:25439317-25439339 GAGGCTGGGGCTTGGAGGAGAGG + Intronic
1006193332 6:32222659-32222681 GAAGCTGGGTGTCAATGGAGAGG + Exonic
1006342283 6:33453228-33453250 CCGGCTGGGTGTATGTGTAGGGG - Exonic
1007517285 6:42422797-42422819 GAGGCTGTGGGGCTGTGGAGAGG - Intronic
1007794177 6:44334316-44334338 GAGGAGGGGTGTGTGGGGAGGGG - Intronic
1007803366 6:44417233-44417255 GATGCTGGCTGTTGGTGGGGTGG + Intronic
1009843376 6:69105571-69105593 GGGGCTGGGAGTTTGGGGAGAGG - Intronic
1009996334 6:70899473-70899495 GAGGCTGGGTGTTAAAGGTGAGG + Intronic
1010181988 6:73097224-73097246 GAGGCTGGGGGTTGGGGGAATGG - Intronic
1011176110 6:84562221-84562243 GTGGGTGGGTGGTGGTGGAGAGG + Intergenic
1013034980 6:106373006-106373028 GAGGCTGTGTGTGTGTGTACAGG + Intergenic
1013437742 6:110128979-110129001 GGGGGTGGGGGTGTGTGGAGTGG - Intronic
1013763866 6:113551574-113551596 GAGGCTATGTGTGTGTTGAGGGG + Intergenic
1013976984 6:116090474-116090496 GAGGTTGGCTGAGTGTGGAGAGG + Intergenic
1014777575 6:125528656-125528678 GGGTGTGGGTGTCTGTGGAGGGG - Intergenic
1015466699 6:133556302-133556324 GAGGCTAGGTGGATGGGGAGGGG - Intergenic
1016424724 6:143922457-143922479 GTGGCAGGGTGCTGGTGGAGAGG - Intronic
1016882175 6:148921926-148921948 GATGCTGGGTGTTTGAGGAGAGG - Intronic
1017722637 6:157254718-157254740 GAGGGTGGAGGTTTGTGGGGAGG + Intergenic
1018870022 6:167775595-167775617 GAGGCTGTGTGTGTGTTGAGGGG - Intergenic
1019560874 7:1656408-1656430 GAGGCTGGGAGACTGTGCAGGGG + Intergenic
1020238477 7:6374497-6374519 GAGGCCGGATGTGAGTGGAGCGG + Intergenic
1021419574 7:20430421-20430443 GAAGCTGAGTGTTTCTGGGGTGG - Intergenic
1021926347 7:25538023-25538045 GGTGCTGGATGTTGGTGGAGGGG - Intergenic
1022117431 7:27274541-27274563 GAGTATGTGTGTGTGTGGAGAGG + Intergenic
1022514448 7:30966382-30966404 GAGGGTGTGTGTGTGTGGGGTGG + Intronic
1023759436 7:43450239-43450261 GAGGTTGGGGGGTTGGGGAGGGG - Intronic
1023874049 7:44277446-44277468 GGGCCTGAGTGTTTCTGGAGTGG + Intronic
1025097652 7:56109118-56109140 GGGACTGGGTGTCTGTGGTGCGG + Intergenic
1026464440 7:70641708-70641730 GAGGCTGGGTGTCTGAGAATTGG - Intronic
1026551575 7:71373374-71373396 GAGGCAGGGAGGTTGGGGAGGGG + Intronic
1026849831 7:73717683-73717705 GAGGGTGGGGGTGTCTGGAGCGG + Intronic
1027239603 7:76318431-76318453 GGGTCTGGGCGTTTGGGGAGGGG + Intergenic
1028960653 7:96746278-96746300 GTGGCTGTCTGTTGGTGGAGTGG + Intergenic
1029286983 7:99472599-99472621 TTGGCTGTGTGTTTGTGGAGGGG - Intergenic
1029358718 7:100072439-100072461 AAAGCTGAGTGTGTGTGGAGGGG + Intronic
1029709297 7:102290810-102290832 GAGGCTGGGTTTATGTGTTGGGG + Intronic
1030483109 7:110129284-110129306 GATGTTGTGTGTTTCTGGAGAGG + Intergenic
1030900117 7:115112879-115112901 GAAGGAGGGTGTTTGTGGATAGG - Intergenic
1031596556 7:123656215-123656237 GAGGCTGGGGGAATGTGGAAAGG + Exonic
1032086682 7:128887376-128887398 GTGGCTGTGTATGTGTGGAGGGG - Intronic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032286473 7:130541499-130541521 GAGACTGGGTGTGTATGGGGTGG + Intronic
1032718131 7:134528319-134528341 TGGGCTGGGTGGTTGAGGAGAGG + Intronic
1032722979 7:134565888-134565910 TGGGCTGGGTGGTTGTGGAGAGG + Intronic
1032921812 7:136557599-136557621 GAGGGTTGGTGTTTGAGGAGAGG + Intergenic
1033131559 7:138749778-138749800 GGGGCAGGGAGTTTGTGGAGGGG - Intronic
1034255779 7:149723966-149723988 GGGCCTGAGTGTTTGTGGTGGGG - Intronic
1034268817 7:149793564-149793586 AGGGCTGGGTCTTGGTGGAGGGG + Intergenic
1034617797 7:152435002-152435024 GGTGCTGGGTGTTGGGGGAGGGG + Intronic
1034781597 7:153887004-153887026 GAGGAGGGGTGTCTGGGGAGGGG + Intergenic
1035236911 7:157503212-157503234 GATGCCTGGTGTTTTTGGAGGGG + Intergenic
1035296792 7:157872040-157872062 GACACTGGGTGTGTGTGGGGAGG - Intronic
1035296805 7:157872112-157872134 GACACTGGGTGTGTGTGGGGAGG - Intronic
1035361977 7:158319502-158319524 GAGGCTGTGTGTGTGGGGGGAGG - Intronic
1035593332 8:835095-835117 GTGCATGGGTGTTTGTGGAGGGG + Intergenic
1037281362 8:17246494-17246516 GGGGCTGGGGGTTTGTCAAGGGG - Intronic
1040385823 8:46914379-46914401 GAGGCTGGATGTTTGAAGAGAGG - Intergenic
1040739904 8:50560706-50560728 GTGGCTGGTTGTTGTTGGAGGGG + Intronic
1041573712 8:59368772-59368794 GAGGCTGTGTGTTCGTGCAGTGG - Intergenic
1042725227 8:71868100-71868122 GGGGCTGGGTGTGTGTGTGGGGG + Intronic
1042874459 8:73428125-73428147 GAGGCTGGGGGTAGGTGGAATGG - Intronic
1044620543 8:94187292-94187314 GAGGCTGGTGGGATGTGGAGGGG - Intronic
1045599278 8:103694388-103694410 GAGGCTGGGTCTTTGTGTGATGG + Intronic
1047754781 8:127910023-127910045 GAGGCTGGGTGTGTGGGGATTGG + Intergenic
1048303504 8:133267761-133267783 GAGGCTCGGAGGTTGGGGAGTGG - Intronic
1049010629 8:139884738-139884760 AAGGCTTGGTGTTTCTGCAGAGG - Intronic
1049278781 8:141733400-141733422 TTGGGTGGGAGTTTGTGGAGGGG + Intergenic
1049387586 8:142351881-142351903 GAGGTGGGGTGAGTGTGGAGGGG - Intronic
1049891648 9:75106-75128 AAGAATGGGTGTTTTTGGAGGGG + Intergenic
1050325186 9:4491146-4491168 GAGGCTGGGGGTGTGGGGTGAGG - Intronic
1053733076 9:41076200-41076222 AAGAATGGGTGTTTTTGGAGGGG + Intergenic
1053752047 9:41266721-41266743 GGGGCTGGGCATGTGTGGAGAGG - Intergenic
1054695346 9:68355359-68355381 AAGAATGGGTGTTTTTGGAGGGG - Intronic
1056772066 9:89484857-89484879 TATACTGGGTGTTTGTGGTGTGG + Intronic
1057427248 9:94962429-94962451 GAGGCTGGGGGTCGGTGCAGAGG + Intronic
1057479627 9:95434392-95434414 GAGTCAGGGTGTGGGTGGAGGGG - Intergenic
1058059759 9:100482602-100482624 GAGGCTGGCTGGTTGAGGACTGG - Intronic
1058848298 9:108984754-108984776 TAGGCTGGGTGTTTCTGGTTAGG - Intronic
1059307633 9:113367332-113367354 GGGGCTGGGTTTTGCTGGAGAGG - Intronic
1060758188 9:126227695-126227717 GAGCCTGTGTGTTAGTGGACAGG + Intergenic
1061118530 9:128629313-128629335 GAGGCTGGGTGCCGGTGCAGTGG - Intronic
1061363477 9:130158130-130158152 GAGCCTGGGTGGTTGGAGAGAGG + Intergenic
1061406291 9:130394600-130394622 GAGGCTGGGGGTTGGGGGAGAGG + Intronic
1061499593 9:130994190-130994212 GAGGATGGGCATTTGAGGAGTGG - Intergenic
1061902290 9:133679077-133679099 GAGCGAGGGTGTTTGTGGAGTGG - Intronic
1062190694 9:135246453-135246475 GGGGCTGGGTGTTCTTGGTGTGG + Intergenic
1185473378 X:398480-398502 TAGGGTGGGTGTTGGTGGTGAGG + Intergenic
1185778911 X:2829128-2829150 GAGGCTGGGGGCTGGGGGAGGGG + Intronic
1186717674 X:12269741-12269763 CTGGCTGTGTGTGTGTGGAGTGG - Intronic
1187562138 X:20412922-20412944 GAGGTTGGGGGTTGGTGGGGGGG + Intergenic
1187950095 X:24463301-24463323 GAAGCTGGATGTTTGTGGAGAGG - Intergenic
1188418634 X:29969866-29969888 GTGGGTGTGTGTTTGTGGTGGGG - Intergenic
1188482601 X:30650736-30650758 GAGGGTGAGTGTGTGTGGTGAGG - Intergenic
1189065294 X:37801640-37801662 GTGTCTGTGTGTTTGTGGAGGGG + Intronic
1189906853 X:45770217-45770239 GGGGCTGGGGGTGTGTGGGGCGG - Intergenic
1190532698 X:51395916-51395938 GCGGTTGGGTGTTTGGGGGGAGG - Intergenic
1190666937 X:52704821-52704843 TAGGGTGGGTGTGTGTGGGGTGG + Intronic
1190672481 X:52753587-52753609 TAGGGTGGGTGTGTGTGGGGTGG - Intronic
1192058194 X:67794792-67794814 GTTGCAGGGAGTTTGTGGAGAGG + Intergenic
1192459079 X:71301933-71301955 GGGGCAGTGTGTTTGAGGAGCGG + Intronic
1193879982 X:86910248-86910270 GAGGCTGGGTCTGTGAGGACTGG + Intergenic
1195416716 X:104628337-104628359 AAGGGTGGGTGTTAGGGGAGGGG - Intronic
1196971881 X:121118511-121118533 GTGGCTGGGTTTTTGTGCCGAGG + Intergenic
1198522054 X:137462917-137462939 GGGGGTGCGTGGTTGTGGAGGGG + Intergenic
1199862703 X:151816152-151816174 GATGCTGGGAATTTGGGGAGGGG + Intergenic
1199932085 X:152533385-152533407 GAGGCCGGGAGCTTGGGGAGAGG - Intergenic
1200148857 X:153941798-153941820 AAGGCTGGGGGTTTCTGCAGAGG - Intronic
1201291116 Y:12421376-12421398 GAGGCTGGGGGCTGGGGGAGGGG - Intergenic