ID: 1136559710

View in Genome Browser
Species Human (GRCh38)
Location 16:31032000-31032022
Sequence GGAGATCCACACTTAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136559709_1136559710 -10 Left 1136559709 16:31031987-31032009 CCACTGTGCAGAGGGAGATCCAC No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559704_1136559710 2 Left 1136559704 16:31031975-31031997 CCCTACAGTTACCCACTGTGCAG No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559700_1136559710 9 Left 1136559700 16:31031968-31031990 CCCATCCCCCTACAGTTACCCAC No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559703_1136559710 3 Left 1136559703 16:31031974-31031996 CCCCTACAGTTACCCACTGTGCA No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559697_1136559710 26 Left 1136559697 16:31031951-31031973 CCCATAAAGATGATCTCCCCATC No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559702_1136559710 4 Left 1136559702 16:31031973-31031995 CCCCCTACAGTTACCCACTGTGC No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559708_1136559710 -9 Left 1136559708 16:31031986-31032008 CCCACTGTGCAGAGGGAGATCCA No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559705_1136559710 1 Left 1136559705 16:31031976-31031998 CCTACAGTTACCCACTGTGCAGA No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559701_1136559710 8 Left 1136559701 16:31031969-31031991 CCATCCCCCTACAGTTACCCACT No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559699_1136559710 10 Left 1136559699 16:31031967-31031989 CCCCATCCCCCTACAGTTACCCA No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data
1136559698_1136559710 25 Left 1136559698 16:31031952-31031974 CCATAAAGATGATCTCCCCATCC No data
Right 1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136559710 Original CRISPR GGAGATCCACACTTAGAGAC AGG Intergenic
No off target data available for this crispr